ID: 1197596998

View in Genome Browser
Species Human (GRCh38)
Location X:128476809-128476831
Sequence TGCCATACCCGGATTGGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197596992_1197596998 5 Left 1197596992 X:128476781-128476803 CCTAACTATGTCCCAATTATTAG No data
Right 1197596998 X:128476809-128476831 TGCCATACCCGGATTGGTTTAGG No data
1197596994_1197596998 -6 Left 1197596994 X:128476792-128476814 CCCAATTATTAGGTGAGTGCCAT No data
Right 1197596998 X:128476809-128476831 TGCCATACCCGGATTGGTTTAGG No data
1197596995_1197596998 -7 Left 1197596995 X:128476793-128476815 CCAATTATTAGGTGAGTGCCATA No data
Right 1197596998 X:128476809-128476831 TGCCATACCCGGATTGGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197596998 Original CRISPR TGCCATACCCGGATTGGTTT AGG Intergenic
No off target data available for this crispr