ID: 1197605751

View in Genome Browser
Species Human (GRCh38)
Location X:128583136-128583158
Sequence CTGTGCCATTGTAACATGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197605751_1197605755 -5 Left 1197605751 X:128583136-128583158 CCATACATGTTACAATGGCACAG No data
Right 1197605755 X:128583154-128583176 CACAGCCAGGACTCAAACAGGGG No data
1197605751_1197605753 -7 Left 1197605751 X:128583136-128583158 CCATACATGTTACAATGGCACAG No data
Right 1197605753 X:128583152-128583174 GGCACAGCCAGGACTCAAACAGG No data
1197605751_1197605757 3 Left 1197605751 X:128583136-128583158 CCATACATGTTACAATGGCACAG No data
Right 1197605757 X:128583162-128583184 GGACTCAAACAGGGGCATCCTGG No data
1197605751_1197605758 11 Left 1197605751 X:128583136-128583158 CCATACATGTTACAATGGCACAG No data
Right 1197605758 X:128583170-128583192 ACAGGGGCATCCTGGCTTCTAGG No data
1197605751_1197605754 -6 Left 1197605751 X:128583136-128583158 CCATACATGTTACAATGGCACAG No data
Right 1197605754 X:128583153-128583175 GCACAGCCAGGACTCAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197605751 Original CRISPR CTGTGCCATTGTAACATGTA TGG (reversed) Intergenic
No off target data available for this crispr