ID: 1197610301

View in Genome Browser
Species Human (GRCh38)
Location X:128630954-128630976
Sequence CACTGGACATCTACCAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197610301_1197610307 -2 Left 1197610301 X:128630954-128630976 CCATACCTGGTAGATGTCCAGTG No data
Right 1197610307 X:128630975-128630997 TGGAAGAGATGGTACTTGATGGG No data
1197610301_1197610308 5 Left 1197610301 X:128630954-128630976 CCATACCTGGTAGATGTCCAGTG No data
Right 1197610308 X:128630982-128631004 GATGGTACTTGATGGGCAAGAGG No data
1197610301_1197610306 -3 Left 1197610301 X:128630954-128630976 CCATACCTGGTAGATGTCCAGTG No data
Right 1197610306 X:128630974-128630996 GTGGAAGAGATGGTACTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197610301 Original CRISPR CACTGGACATCTACCAGGTA TGG (reversed) Intergenic
No off target data available for this crispr