ID: 1197610446

View in Genome Browser
Species Human (GRCh38)
Location X:128632474-128632496
Sequence CCTCAAGTGCTTTAGATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197610446_1197610451 3 Left 1197610446 X:128632474-128632496 CCTTCCATCTAAAGCACTTGAGG No data
Right 1197610451 X:128632500-128632522 GTAAGGGATTATATAAAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197610446 Original CRISPR CCTCAAGTGCTTTAGATGGA AGG (reversed) Intergenic
No off target data available for this crispr