ID: 1197610522

View in Genome Browser
Species Human (GRCh38)
Location X:128633300-128633322
Sequence CAATTGCTACAGAATCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197610518_1197610522 27 Left 1197610518 X:128633250-128633272 CCTTTTATAAACTTGTAGCAGAG No data
Right 1197610522 X:128633300-128633322 CAATTGCTACAGAATCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197610522 Original CRISPR CAATTGCTACAGAATCACCC AGG Intergenic
No off target data available for this crispr