ID: 1197615658

View in Genome Browser
Species Human (GRCh38)
Location X:128687745-128687767
Sequence AAATTGAAAGAGATTTATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197615654_1197615658 -4 Left 1197615654 X:128687726-128687748 CCCAAAAGCTAAGAAAAGAAAAT No data
Right 1197615658 X:128687745-128687767 AAATTGAAAGAGATTTATAGGGG No data
1197615653_1197615658 22 Left 1197615653 X:128687700-128687722 CCATTAACTCTAAAGGATAAGAA No data
Right 1197615658 X:128687745-128687767 AAATTGAAAGAGATTTATAGGGG No data
1197615655_1197615658 -5 Left 1197615655 X:128687727-128687749 CCAAAAGCTAAGAAAAGAAAATT No data
Right 1197615658 X:128687745-128687767 AAATTGAAAGAGATTTATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197615658 Original CRISPR AAATTGAAAGAGATTTATAG GGG Intergenic
No off target data available for this crispr