ID: 1197623541

View in Genome Browser
Species Human (GRCh38)
Location X:128779028-128779050
Sequence GGTACCAACGTGCCCACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 7, 3: 75, 4: 225}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197623541 Original CRISPR GGTACCAACGTGCCCACAGT AGG (reversed) Intergenic
901038255 1:6349242-6349264 GGTACCACTGTGCCCACAATGGG - Intronic
903189844 1:21650466-21650488 GGCACCAAGGTGCCCTCAGAGGG - Intronic
907023767 1:51095036-51095058 GGTACCAGCTTGGCCACAGTGGG + Intergenic
908302297 1:62774035-62774057 GGTACCAGTTTGGCCACAGTGGG - Intergenic
909209702 1:72807974-72807996 GGTACCAACTTGGCCATAGTGGG - Intergenic
910330665 1:86069126-86069148 TGTACCAGCTTGGCCACAGTAGG + Intronic
910379264 1:86608771-86608793 GGTACCAGCATGGCCACAGTGGG - Intergenic
911019854 1:93375443-93375465 GGTACCAGCTTGGCCATAGTGGG + Intergenic
911948306 1:104138857-104138879 GGTTCAAACTTGCCCCCAGTTGG - Intergenic
912015350 1:105027505-105027527 GGTACCAGCTTGGCCACATTGGG + Intergenic
912018444 1:105072197-105072219 GGTACCAGCTTGGCCACAGTTGG - Intergenic
912871531 1:113311290-113311312 GGTACCAGCTTGGTCACAGTGGG + Intergenic
913416858 1:118618587-118618609 GGTACCAGCTTGACCACAGGGGG - Intergenic
915693643 1:157716335-157716357 GGTACCAGCTCGGCCACAGTTGG - Intergenic
916312462 1:163412223-163412245 GGTACAAAATTGCCCACAGCTGG - Intergenic
916499136 1:165371501-165371523 GTTTCCACAGTGCCCACAGTAGG + Intergenic
916743193 1:167663796-167663818 GATACCAACTGGCACACAGTAGG - Intronic
917191373 1:172422638-172422660 GGTACCAGCTTAGCCACAGTGGG + Intronic
917300576 1:173570144-173570166 GGTACCAGCTTGGCCACAGTGGG - Intronic
918243572 1:182640633-182640655 GGTCCCAATGGGCCCACTGTGGG + Intergenic
919272064 1:195360600-195360622 GGTACTAGCATGGCCACAGTGGG + Intergenic
919380050 1:196848225-196848247 GGTACCAGCATGGCCACAGTGGG - Intronic
921456754 1:215380537-215380559 GGTACCAGCATGGCCACAGGAGG + Intergenic
922358105 1:224795665-224795687 GGTACCAACTTGGCCACAATGGG - Intergenic
922377149 1:224980143-224980165 GGTACTATCTTGGCCACAGTGGG + Intronic
923879004 1:238083478-238083500 GGTACCAGCATGGCCACAGTGGG - Intergenic
923886615 1:238164568-238164590 GGTACCAACTCAGCCACAGTGGG - Intergenic
1065381531 10:25096011-25096033 GGTACCAGCTTGGCCACAGAGGG - Intergenic
1071197226 10:83175481-83175503 GGTACCAACACTGCCACAGTGGG - Intergenic
1071767811 10:88689133-88689155 GGTGCCAACTTGACCACCGTGGG + Intergenic
1071799430 10:89042549-89042571 GGTACCAGCTTAGCCACAGTGGG - Intergenic
1071869741 10:89780971-89780993 GGTACCAGCATGGCCACAGTGGG - Intergenic
1071935512 10:90526243-90526265 GGTACCAGGTTGGCCACAGTGGG - Intergenic
1073823392 10:107291410-107291432 GGTACCAGCTCGGCCACAGTGGG - Intergenic
1074408476 10:113201800-113201822 GGTAACAGCTTGGCCACAGTGGG + Intergenic
1076399931 10:130175853-130175875 GATGCCACCATGCCCACAGTGGG - Intronic
1077427434 11:2489923-2489945 GGTACCAGCTTGACCACAGTGGG + Intronic
1077999966 11:7485656-7485678 GGGACCAACTTGCCAACAGCTGG + Exonic
1078194233 11:9121630-9121652 GTTGCCAACCTGCCCACACTGGG - Intronic
1079473890 11:20808040-20808062 GGTACCAGCTTGGCCACAGTGGG - Intronic
1079712858 11:23708304-23708326 GGTACCAACACCACCACAGTGGG + Intergenic
1080128580 11:28766739-28766761 GGTACTAGCTTGGCCACAGTGGG + Intergenic
1080489833 11:32750802-32750824 GGTACCAGCTTGGCTACAGTGGG - Intronic
1080749358 11:35138653-35138675 AGTGCCTCCGTGCCCACAGTGGG - Intergenic
1081073713 11:38642352-38642374 GGTACCAGCTTGGCCACAGTGGG - Intergenic
1081212585 11:40354827-40354849 GGTACCAGGTTGGCCACAGTAGG - Intronic
1083863709 11:65441947-65441969 GGAACCAGCGTGGCCACAGCGGG - Intergenic
1085008179 11:73114424-73114446 GGTATCAGCTTGGCCACAGTTGG - Intronic
1085178450 11:74511274-74511296 GATACCACCTTGGCCACAGTGGG + Intronic
1085194734 11:74662176-74662198 GTAACCAGCTTGCCCACAGTGGG - Intronic
1085981640 11:81733109-81733131 GGTCCCAACATGGCCACAGTAGG - Intergenic
1086468189 11:87076528-87076550 GGTACCAGCTTGGACACAGTGGG - Intronic
1087032016 11:93715478-93715500 GGTACCAGCTTGGCCACAGTGGG - Intronic
1087417134 11:97871556-97871578 GGTCCCAATTTGGCCACAGTGGG - Intergenic
1087472973 11:98600838-98600860 GGTACCAGCTTGGCCACAGTGGG - Intergenic
1088009821 11:104986471-104986493 GGTACCAGCTTGGCCACAGTGGG + Intergenic
1088944457 11:114495504-114495526 GGTACCAACTTGGTTACAGTGGG - Intergenic
1089726512 11:120485212-120485234 AGTCCCAAGGTGCCCAGAGTGGG + Exonic
1089946524 11:122479824-122479846 GATACCAGCTTGCCCACAGTGGG + Intergenic
1090676898 11:129007219-129007241 GGTACCAGCTTGGCCACAGTGGG - Intronic
1093931811 12:24961474-24961496 GGTACCAGCTTGGCCACAGTGGG + Intergenic
1096237835 12:49942105-49942127 GGGACCACTGTCCCCACAGTGGG - Intergenic
1096343953 12:50828757-50828779 GGTACCAGCTCGGCCACAGTAGG - Intergenic
1096408508 12:51360775-51360797 GGTACCGATGTGCTCAAAGTAGG + Exonic
1097769920 12:63572074-63572096 GGTACCAGCTTGGCCGCAGTGGG + Intronic
1098649063 12:72941393-72941415 GGTACCAGCTGGGCCACAGTGGG - Intergenic
1099024512 12:77448402-77448424 AGTACCAGCTTGGCCACAGTGGG + Intergenic
1099826110 12:87779756-87779778 GGTACCAGCTTGACCACAGTAGG - Intergenic
1105434946 13:20368391-20368413 GGTAACACAGTGCCCAAAGTAGG + Intergenic
1106074782 13:26448722-26448744 GGTACCAGTTTGGCCACAGTGGG + Intergenic
1107210869 13:37852618-37852640 GGTACCAGCTTGCACACAGTGGG + Intronic
1108124424 13:47225626-47225648 TATACCAACATGCACACAGTGGG - Intergenic
1110915172 13:81012168-81012190 GGTACCAGCTTGACCACAATAGG - Intergenic
1110974185 13:81808516-81808538 GGTACCAGATTGTCCACAGTGGG + Intergenic
1111291939 13:86182730-86182752 GCTACCACCTTGGCCACAGTGGG + Intergenic
1111639318 13:90947440-90947462 AGTACCAGCTTGGCCACAGTGGG + Intergenic
1113244239 13:108376951-108376973 GGTACCACCTTGGGCACAGTAGG - Intergenic
1115683304 14:35766138-35766160 GAAACCAACAAGCCCACAGTAGG - Intronic
1116045743 14:39740519-39740541 GGTACCAGCTTGGCTACAGTGGG + Intergenic
1116765953 14:49070715-49070737 GGTACGAGCTTGGCCACAGTTGG + Intergenic
1117264921 14:54076794-54076816 AGTACCAGCATGGCCACAGTGGG - Intergenic
1117795415 14:59388556-59388578 GGTACCAGCTGGGCCACAGTTGG - Intergenic
1118235070 14:63995480-63995502 GTTACTAAAGTACCCACAGTTGG + Intronic
1118539039 14:66802450-66802472 GGTACCAACTTGGCCACAGGGGG - Intronic
1119096812 14:71840420-71840442 GGTACCAGCTCGGCCACAGTGGG - Intergenic
1120275724 14:82370416-82370438 GGTATCAACTTGGCCACAGTGGG + Intergenic
1120426184 14:84351097-84351119 GGTACCACCTTGGCTACAGTGGG + Intergenic
1126440546 15:48683659-48683681 GGTACCAGCCTGGCCACAGTGGG + Intergenic
1126517620 15:49553889-49553911 GGTACCAGCATGGCCACAGGTGG - Intronic
1126869113 15:52968691-52968713 GATACCACAGTGCCCTCAGTGGG + Intergenic
1126979825 15:54228343-54228365 GGTACCAGCTTGGCCACAGTGGG - Intronic
1127132613 15:55883043-55883065 GGTACCAGCTTGGCCACAGTAGG + Intronic
1127971528 15:63965945-63965967 GGTACTAGCTTGACCACAGTGGG - Intronic
1129561763 15:76577857-76577879 GGTATCAGCTTGACCACAGTAGG + Intronic
1130895956 15:88170721-88170743 GGTCCCAACAGGCCCACTGTAGG + Intronic
1131315103 15:91328948-91328970 GGCACCAGCTTGACCACAGTGGG - Intergenic
1132230631 15:100181302-100181324 GGTACCAGCTTGGCCACAGTGGG - Intronic
1135879561 16:26240824-26240846 GGTACCAGCATGGCCACAGTGGG + Intergenic
1136676580 16:31913900-31913922 GGTACCAGCTTGGCCACAGTGGG - Intronic
1141322264 16:83022464-83022486 GGTACCAATGTGCCTTCAGTTGG - Intronic
1142024887 16:87807113-87807135 GGTGCCAACCTGCCCACAAAGGG - Intergenic
1142115150 16:88352623-88352645 GGTACCAAAGTGCCCACCATCGG - Intergenic
1145014872 17:19390108-19390130 GGTAATAACATGCCCAGAGTCGG + Intergenic
1152789359 17:82270440-82270462 GATACCAAAGTGACAACAGTAGG + Intronic
1154230653 18:12553230-12553252 GGTACCAGCTTGGCCACAGTGGG + Intronic
1155024796 18:21931276-21931298 GGCACCTACCTGCCCACAATTGG - Intergenic
1155282138 18:24250759-24250781 AGTACCAGCTTGGCCACAGTGGG + Intronic
1158468606 18:57713939-57713961 GCTACCACCTTGGCCACAGTGGG + Intronic
1159092021 18:63860494-63860516 GGTACCAACTTGGCCACAGTGGG - Intergenic
1159339675 18:67118991-67119013 GGTACCAGCTTGGCCACAGTCGG - Intergenic
1159446256 18:68544980-68545002 GATACCAGCTTACCCACAGTAGG + Intergenic
1162693025 19:12449453-12449475 GGTACCAGCTTGTCCACAGTGGG - Intronic
1163185419 19:15635773-15635795 GGTACCAGCTTAGCCACAGTGGG - Intronic
1165645409 19:37431684-37431706 GGTACCAACTTGGCCACAATGGG + Intronic
928863959 2:35895503-35895525 GGTACCAGCTTGGTCACAGTGGG - Intergenic
929527680 2:42721034-42721056 GAGACCAATTTGCCCACAGTAGG - Intronic
930878298 2:56244558-56244580 GGTACCAGCTTATCCACAGTAGG - Intronic
931944044 2:67285329-67285351 GGAACCACTGTGCCCACAGTGGG - Intergenic
932921143 2:75916624-75916646 GGTACCAGCTTGGCCACAGTGGG - Intergenic
935078618 2:99770475-99770497 GGTACCAGCTTGGCCACAGCAGG - Intronic
935437860 2:103056090-103056112 GGTGCCACCTTGGCCACAGTGGG - Intergenic
939273601 2:139971126-139971148 GGTAACACCTTGGCCACAGTGGG + Intergenic
940947748 2:159637196-159637218 GGTACCAGCTTGTACACAGTGGG + Intergenic
942778483 2:179613225-179613247 GGTACCAGCTCGGCCACAGTTGG - Intronic
943067611 2:183105428-183105450 GGTACCAGCATGGCCACAGTTGG - Intergenic
943831763 2:192472701-192472723 GGTACCAGCTTGACCACAGAGGG + Intergenic
944133251 2:196370011-196370033 GGTACCAGCTTGTCCACAATGGG - Intronic
944550401 2:200839884-200839906 GGTACCAGCTTGGGCACAGTGGG + Intergenic
944760388 2:202808127-202808149 GGCACCAGCTTGGCCACAGTGGG + Intronic
944855138 2:203760057-203760079 GATACCAACTCACCCACAGTAGG - Intergenic
945461573 2:210115984-210116006 GTTACCAGCTTGGCCACAGTGGG + Intronic
947009131 2:225546679-225546701 GGTGCCAGCTTGGCCACAGTTGG - Intronic
947122996 2:226836355-226836377 GGGAACGACGTGCCCACACTCGG + Intronic
947130906 2:226923997-226924019 GGTACCAGCTTGGCCACAGCAGG - Intronic
947439740 2:230108987-230109009 GGTACCAGCTTGGCCACAGTGGG - Intergenic
1168899922 20:1354749-1354771 GGTACCAGCTTGGCCACAGTTGG - Intronic
1170668393 20:18406700-18406722 GGTACCAGCTTGAACACAGTGGG + Intronic
1175632170 20:60550409-60550431 GGTACCAACTCAGCCACAGTAGG - Intergenic
1177401051 21:20605856-20605878 GGTATCAGCATGCCCACAGCAGG + Intergenic
1177577956 21:22982908-22982930 GGTCCCAGCATGGCCACAGTGGG + Intergenic
1181179284 22:21055657-21055679 GGGACCACTGTGCCCACAGCAGG + Intronic
1182617153 22:31594922-31594944 GGGACAAACTTGCCCACAGCAGG + Intronic
1183387981 22:37526007-37526029 GGTCCACACGTGCCCACTGTGGG - Intergenic
949829254 3:8196810-8196832 GGTACCAGCTTGGCCACAGAGGG - Intergenic
951172145 3:19554732-19554754 GGTATCAGCATGGCCACAGTAGG - Intergenic
951279538 3:20731540-20731562 GGTACCATCTTGGCCACAGTGGG - Intergenic
953722586 3:45369259-45369281 GGTACCAGCATGGCCACAGAGGG + Intergenic
954797068 3:53166959-53166981 GGGGCCAAGGTGCTCACAGTGGG + Intronic
956436227 3:69237092-69237114 CTTACCAAAGTTCCCACAGTAGG + Intronic
957907654 3:86578489-86578511 GATACCAACTTAGCCACAGTAGG - Intergenic
958756885 3:98260134-98260156 GGTACGAACATCACCACAGTTGG - Intergenic
958760176 3:98297048-98297070 GGTACCAGTTTGGCCACAGTGGG + Intergenic
959409060 3:105997734-105997756 GGTACCAGCTTGGCCTCAGTGGG - Intergenic
959806597 3:110562061-110562083 GGTACCAGGTTGGCCACAGTGGG - Intergenic
959818904 3:110708675-110708697 GGTACCAGCTTGGCCACAGCAGG - Intergenic
959868530 3:111300035-111300057 GATACCAGCTTGGCCACAGTGGG - Intronic
963020464 3:140868653-140868675 GATACCAACTCGGCCACAGTGGG - Intergenic
963330549 3:143910285-143910307 GGTACCAACTAGGCCACAGTGGG + Intergenic
964179408 3:153865481-153865503 GGTACAAGCTTGGCCACAGTGGG + Intergenic
964398436 3:156272699-156272721 GGTACCAGCTTGGCGACAGTGGG - Intronic
965250834 3:166342359-166342381 GGTACCAAGTTGGCCACAGTGGG + Intergenic
965379266 3:167967596-167967618 GGTACCAGCCGGGCCACAGTGGG + Intergenic
966151110 3:176868660-176868682 GGTACCATCTTAGCCACAGTGGG + Intergenic
966329037 3:178790417-178790439 GGTACCAACTTGGCCACAGTAGG + Intronic
967264822 3:187681162-187681184 AATTCCAACGTGTCCACAGTTGG - Intergenic
967608954 3:191481866-191481888 GGTATCAGCTTGGCCACAGTGGG + Intergenic
968718316 4:2178435-2178457 GGTGGCAATGTGGCCACAGTTGG - Intronic
972253816 4:37332742-37332764 GGTACCAGCTCGGCCACAGTAGG + Intronic
972902364 4:43700567-43700589 GGTACCAACATGGCCACAGTGGG - Intergenic
974298975 4:60040547-60040569 GGTACCAGCTTGGCCACAGAAGG - Intergenic
974301024 4:60067412-60067434 GGTACCAGCTTGGACACAGTAGG + Intergenic
977458593 4:97296265-97296287 GGTACCAGCTTGGCTACAGTGGG - Intronic
977744996 4:100535947-100535969 GGTACCAGCATGGCCACAGAGGG + Intronic
979213281 4:118132556-118132578 TGTACCAGCTTGGCCACAGTGGG - Intronic
979396740 4:120198033-120198055 GCTACCAACTTGGCCATAGTGGG + Intergenic
979413472 4:120406930-120406952 GGTACCAACACTGCCACAGTGGG + Intergenic
979565067 4:122145663-122145685 GGTACCAGGTTGGCCACAGTGGG - Intergenic
979594993 4:122525183-122525205 GGTACCAACACTGCCACAGTGGG - Intergenic
979945833 4:126830332-126830354 GGTACCAGCTTGACAACAGTGGG + Intergenic
980081621 4:128350577-128350599 GGTACCCCCGCCCCCACAGTCGG - Intergenic
980172394 4:129305735-129305757 GGTACCAGCTTGGCCACAGTGGG - Intergenic
980960559 4:139470527-139470549 GGTACCAGCATGGCCACAGGGGG - Intronic
981518352 4:145634553-145634575 GGTACTAGCCTGGCCACAGTGGG - Intronic
981530804 4:145752140-145752162 GGTACCAGCTTGACCACAGTGGG - Intronic
981871087 4:149486925-149486947 GGTGCCAGCTTGGCCACAGTAGG - Intergenic
983338064 4:166421235-166421257 GGTACCAGCTTGGCCAAAGTGGG - Intergenic
983766530 4:171490824-171490846 GGTGCCAACCTGCCCATGGTTGG - Intergenic
984656505 4:182324423-182324445 GGCACCAATGTGCCCACCGGTGG - Intronic
986352445 5:6893188-6893210 CGTACCCACGGTCCCACAGTGGG - Intergenic
986885238 5:12226030-12226052 GGTACCAGCTTGGCCACAGTAGG - Intergenic
987457905 5:18169787-18169809 GGTACCAGCTTGGCCACAGTGGG + Intergenic
988001747 5:25358544-25358566 GGTGCCAGCTTGACCACAGTGGG + Intergenic
988376227 5:30439413-30439435 GGCATCAGCTTGCCCACAGTAGG + Intergenic
989657713 5:43762060-43762082 GGTACCAGCTTGCCTACAATGGG - Intergenic
990514885 5:56521751-56521773 GGTACAAAAGTGCCCACTGAGGG + Intronic
991066870 5:62433392-62433414 TATACGAACGTGCCTACAGTTGG - Intronic
991682122 5:69150051-69150073 GGTACCAGCTTAGCCACAGTGGG - Intergenic
992345185 5:75869168-75869190 GGTACCCACCTGGCCACAGGGGG + Intergenic
992934538 5:81688011-81688033 GGTACCAGCTTGGCCACAGTAGG + Intronic
993197248 5:84764652-84764674 GGTACCAGTATGGCCACAGTGGG - Intergenic
994310075 5:98259297-98259319 GGTACCAGGTTGGCCACAGTGGG - Intergenic
994355032 5:98785223-98785245 GGTACTAAAGGGCCCACTGTGGG + Intronic
994853786 5:105090781-105090803 GGTACCAGCTTGGCCACAGCAGG + Intergenic
994853827 5:105091130-105091152 GATACCAACTTGGCCACAGGTGG + Intergenic
995514837 5:112944084-112944106 GGTACGATCTTGGCCACAGTGGG + Intergenic
996459541 5:123725513-123725535 GGTACCAGCTTGGCTACAGTAGG + Intergenic
996666570 5:126066738-126066760 GGTACCAGCTTGGCCACAGTGGG + Intergenic
997003044 5:129784894-129784916 GGTACCAGCTTGGCCACAATAGG + Intergenic
999002525 5:147939745-147939767 GGTACTAGCTTGGCCACAGTGGG - Intergenic
999281796 5:150371097-150371119 GAGACCAAGGTGTCCACAGTTGG + Intronic
1000270234 5:159677186-159677208 GGTACCAGCATGGCCACAGTCGG + Intergenic
1006554237 6:34852114-34852136 GGTACCAGCTTGGCCATAGTGGG - Intronic
1008312169 6:49989873-49989895 GGTACCAGCATGCCCACAGTGGG + Intergenic
1008822536 6:55651031-55651053 GGTTCCAACTTGGCCACAGCAGG - Intergenic
1008880760 6:56378227-56378249 GGTACTAGCTTGGCCACAGTGGG + Intronic
1010325062 6:74554888-74554910 GATACCAGCATGGCCACAGTGGG + Intergenic
1010596545 6:77770006-77770028 GGTACCAGCTTGGCCGCAGTGGG + Intronic
1010838819 6:80623422-80623444 GGTACCAGCTTGGCCACAGTGGG + Intergenic
1011333224 6:86233550-86233572 GGTACCAGCTTAGCCACAGTAGG - Intergenic
1011586538 6:88932317-88932339 GGTGACAACGTGTGCACAGTGGG + Intronic
1012224501 6:96688797-96688819 GGTACCAGCTTGGCCACAGTGGG + Intergenic
1012714037 6:102646555-102646577 GGTACCAGCATGGCCACAGGAGG + Intergenic
1013062679 6:106652253-106652275 GAAACCAACAAGCCCACAGTGGG - Exonic
1014862260 6:126484637-126484659 GGTACCAATTTGGCCACAATGGG + Intergenic
1015460714 6:133487887-133487909 GGTACCAGCTTGGCAACAGTGGG + Intronic
1015907302 6:138130081-138130103 GATACCAGCTTGGCCACAGTGGG + Intergenic
1016054746 6:139566874-139566896 GGTACTAGCGTGGCCACAGTAGG - Intergenic
1016623808 6:146142885-146142907 AGTACCAGCTTGGCCACAGTGGG - Intronic
1022366977 7:29730692-29730714 GGTACCAGCTTGGCCACAGTGGG - Intergenic
1022541968 7:31146014-31146036 GGTACCAGCTTGGCCACAGTGGG - Intergenic
1024766009 7:52660265-52660287 GCTACCAACATGTGCACAGTTGG + Intergenic
1027524074 7:79245283-79245305 GGTACTAACATGACCACAGAGGG + Intronic
1027674717 7:81143336-81143358 GGTACCAGCATGGCCACAGTGGG + Intergenic
1029026123 7:97418612-97418634 AGTACCAATGGGCCCACATTAGG + Intergenic
1029825289 7:103186763-103186785 GGTACCAGCTTGGCCTCAGTGGG + Intergenic
1031288367 7:119900828-119900850 GGTACCACCTTGGCCACAGCAGG - Intergenic
1031615285 7:123872443-123872465 GTAAGCAACGTGCCCACTGTGGG - Intronic
1033691328 7:143740431-143740453 GGTACCAGCATGGCCACAGAAGG + Intergenic
1034581782 7:152050101-152050123 GGTATCAGTGTGGCCACAGTGGG - Intronic
1035139098 7:156738980-156739002 GGTACTAGCTTGGCCACAGTGGG + Intronic
1035754050 8:2017887-2017909 AGTACCATCTTGGCCACAGTAGG - Intergenic
1036936242 8:13004820-13004842 GGTACCAGCTCGGCCACAGTGGG + Intronic
1042082538 8:65071062-65071084 GGTACCAGCTTGGCCACAGTAGG - Intergenic
1042297943 8:67242673-67242695 GGTACCAGCTTGGCCACAGAAGG + Intronic
1043312423 8:78876819-78876841 GGTACCAATTTAGCCACAGTAGG - Intergenic
1045041311 8:98227243-98227265 GGTACCAGCTTGGCCACAGTGGG - Intronic
1045172530 8:99686850-99686872 GGTACCAGCTAGCCCACAGTGGG - Intronic
1045994921 8:108351712-108351734 GGTACCAGCTCGGCCACAGTAGG + Intronic
1046114147 8:109765222-109765244 GGTACCAGCTTGGCCACAGTGGG - Intergenic
1046211342 8:111080875-111080897 GGTACCAGCTTGGCCACAGGTGG - Intergenic
1046463297 8:114570413-114570435 GGTACCAGCTAGGCCACAGTGGG - Intergenic
1050145205 9:2560162-2560184 GGTACCAGCTTGGCCACAGAAGG + Intergenic
1050807147 9:9694952-9694974 GGTACCAGCTTGGCCACAGTAGG - Intronic
1051137959 9:13944540-13944562 GGTACACACCTGCCCAAAGTTGG - Intergenic
1051966655 9:22836264-22836286 GGAATCAACTTGGCCACAGTGGG - Intergenic
1053040061 9:34862798-34862820 GGTACCAGCTTGGCCACAGGGGG + Intergenic
1053110218 9:35453431-35453453 GGTACCAACTCAGCCACAGTGGG + Intergenic
1053204443 9:36174214-36174236 GGTACCAGCTTGGCCACAGTGGG + Intergenic
1055181207 9:73388875-73388897 AGTATCAACTTGGCCACAGTGGG - Intergenic
1055886472 9:81069411-81069433 GGTACCAACTCAGCCACAGTGGG - Intergenic
1057289061 9:93788795-93788817 GGTACCAGCTTGGCCACAGCTGG - Intergenic
1058226519 9:102371300-102371322 GGTACCAGCATGGCCACAGTGGG - Intergenic
1058249065 9:102668881-102668903 GGTACCAGCTTGGTCACAGTGGG - Intergenic
1059041741 9:110822460-110822482 GGTACCAGCTGGACCACAGTGGG + Intergenic
1059598274 9:115746835-115746857 GGTACAAAACTGCTCACAGTGGG - Intergenic
1185723618 X:2401937-2401959 GGAAGCTACGTGCCCACAGAAGG - Intronic
1187314813 X:18183539-18183561 GGTCCCAGCTTGGCCACAGTGGG + Intronic
1188161838 X:26814290-26814312 GGTACCAACTTGGCCACAGTGGG - Intergenic
1189593853 X:42543619-42543641 GGTACCAGCTTGGCCATAGTGGG + Intergenic
1189881464 X:45497852-45497874 GGTACCAGCTTGGCCACAGTTGG - Intergenic
1190122339 X:47672429-47672451 GGTACCAGCTTAGCCACAGTGGG - Intergenic
1190537756 X:51446606-51446628 GGTACCAGCTTGGCCACAGTGGG - Intergenic
1190808345 X:53860850-53860872 GGTACCAACTTGGCCACAGTGGG - Intergenic
1191048858 X:56169349-56169371 GGTACCAGCTTGGCCACAGGAGG + Intergenic
1191826933 X:65375948-65375970 GGTACCAGCTTGGCCACAGGAGG + Intronic
1192135059 X:68589321-68589343 GGTACTAACTCGGCCACAGTGGG + Intergenic
1192406019 X:70887227-70887249 GGTGCCACCTTGGCCACAGTAGG + Intronic
1192614718 X:72607953-72607975 GGTACCAGGTTGGCCACAGTGGG - Intronic
1192839181 X:74836281-74836303 GGTACCAACTTGACCAAAGTGGG - Intronic
1192908542 X:75578793-75578815 GGTACCAGCATGGCCACAGTGGG - Intergenic
1192995456 X:76507613-76507635 GGTACCAGCTTGGCCACAGATGG - Intergenic
1193191861 X:78579934-78579956 GGTACCAGCTTGACCACAGAGGG - Intergenic
1193305796 X:79949776-79949798 GGTACCAACTCAACCACAGTGGG + Intergenic
1193524507 X:82572741-82572763 GGTACCAGCATGGCCACAGTGGG - Intergenic
1193899621 X:87161411-87161433 GGAACCAGCTTGACCACAGTGGG - Intergenic
1194033160 X:88840371-88840393 GCTACCAGCTTGGCCACAGTGGG + Intergenic
1194065284 X:89253402-89253424 AGTATCAACGTGCCCACAATGGG + Intergenic
1194136644 X:90152054-90152076 CGTACCAACATGGCCACAGTGGG + Intergenic
1194291061 X:92072283-92072305 GGTACCAGCTTGGCCACAGTGGG - Intronic
1194479354 X:94401112-94401134 GGTACCAGCTTGTCCAGAGTGGG - Intergenic
1195136211 X:101909424-101909446 GGTACCAACACCACCACAGTGGG + Intronic
1195199365 X:102532943-102532965 GGTACCAGCTTGGCCACATTAGG + Intergenic
1195783033 X:108485292-108485314 GGTACCAACTCTGCCACAGTGGG - Intronic
1196247393 X:113415753-113415775 GGTACCAGCTTGGCCACAGAGGG + Intergenic
1196248434 X:113428773-113428795 GGTACCAGCTTGGCCATAGTGGG + Intergenic
1197015992 X:121626894-121626916 GGTACCAGCTTGGCCACAGTGGG + Intergenic
1197072932 X:122322176-122322198 GGTACCAACTTGGCCACAGTGGG + Intergenic
1197096686 X:122604636-122604658 GGTACCAGCATGGCCACAGGAGG + Intergenic
1197099558 X:122636599-122636621 GGTACCAGCTTGGCCATAGTGGG - Intergenic
1197361122 X:125504773-125504795 GGTACCACCTTGACCATAGTGGG - Intergenic
1197623541 X:128779028-128779050 GGTACCAACGTGCCCACAGTAGG - Intergenic
1199018470 X:142847516-142847538 GATACCCACGTAGCCACAGTGGG - Intergenic
1199239151 X:145526393-145526415 GGTACCAGCATGGCCACAGGGGG + Intergenic
1199308677 X:146297481-146297503 GGTACCAGCATGGCCACAGAGGG - Intergenic
1199457382 X:148044224-148044246 GGTACCAGCTTGGCCACAGTGGG - Intergenic
1200608570 Y:5296858-5296880 GATACCAGCTTGGCCACAGTGGG - Intronic
1200719455 Y:6587486-6587508 AGTATCAACGTGCCCACAATGGG + Intergenic
1201595103 Y:15659568-15659590 GGTAACAAGGCTCCCACAGTGGG + Intergenic