ID: 1197629168 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:128838021-128838043 |
| Sequence | CTAGTATGAAGTAGAATAGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197629168_1197629172 | 16 | Left | 1197629168 | X:128838021-128838043 | CCTACTATTCTACTTCATACTAG | No data | ||
| Right | 1197629172 | X:128838060-128838082 | CAGTTGAATAACAATGGATTGGG | No data | ||||
| 1197629168_1197629170 | 10 | Left | 1197629168 | X:128838021-128838043 | CCTACTATTCTACTTCATACTAG | No data | ||
| Right | 1197629170 | X:128838054-128838076 | AATCTTCAGTTGAATAACAATGG | No data | ||||
| 1197629168_1197629171 | 15 | Left | 1197629168 | X:128838021-128838043 | CCTACTATTCTACTTCATACTAG | No data | ||
| Right | 1197629171 | X:128838059-128838081 | TCAGTTGAATAACAATGGATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197629168 | Original CRISPR | CTAGTATGAAGTAGAATAGT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||