ID: 1197629168

View in Genome Browser
Species Human (GRCh38)
Location X:128838021-128838043
Sequence CTAGTATGAAGTAGAATAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197629168_1197629172 16 Left 1197629168 X:128838021-128838043 CCTACTATTCTACTTCATACTAG No data
Right 1197629172 X:128838060-128838082 CAGTTGAATAACAATGGATTGGG No data
1197629168_1197629170 10 Left 1197629168 X:128838021-128838043 CCTACTATTCTACTTCATACTAG No data
Right 1197629170 X:128838054-128838076 AATCTTCAGTTGAATAACAATGG No data
1197629168_1197629171 15 Left 1197629168 X:128838021-128838043 CCTACTATTCTACTTCATACTAG No data
Right 1197629171 X:128838059-128838081 TCAGTTGAATAACAATGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197629168 Original CRISPR CTAGTATGAAGTAGAATAGT AGG (reversed) Intergenic
No off target data available for this crispr