ID: 1197629466

View in Genome Browser
Species Human (GRCh38)
Location X:128841836-128841858
Sequence TATATGTACTCTCTGTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197629464_1197629466 28 Left 1197629464 X:128841785-128841807 CCAAATCGGCTGAGGGCACAGAC No data
Right 1197629466 X:128841836-128841858 TATATGTACTCTCTGTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197629466 Original CRISPR TATATGTACTCTCTGTCTTC TGG Intergenic
No off target data available for this crispr