ID: 1197633272

View in Genome Browser
Species Human (GRCh38)
Location X:128886609-128886631
Sequence CCTGCTTTTTCTAACCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197633267_1197633272 10 Left 1197633267 X:128886576-128886598 CCTCAGCAAGCCAACTTATTCTA No data
Right 1197633272 X:128886609-128886631 CCTGCTTTTTCTAACCATGCTGG No data
1197633268_1197633272 0 Left 1197633268 X:128886586-128886608 CCAACTTATTCTACCTTCTTCCA No data
Right 1197633272 X:128886609-128886631 CCTGCTTTTTCTAACCATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197633272 Original CRISPR CCTGCTTTTTCTAACCATGC TGG Intergenic
No off target data available for this crispr