ID: 1197635846

View in Genome Browser
Species Human (GRCh38)
Location X:128914123-128914145
Sequence AAGGTGAGCTCACTATAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197635840_1197635846 15 Left 1197635840 X:128914085-128914107 CCAATCATTCACATCTTAATAGG No data
Right 1197635846 X:128914123-128914145 AAGGTGAGCTCACTATAGGTTGG No data
1197635839_1197635846 26 Left 1197635839 X:128914074-128914096 CCTCAGCTTTACCAATCATTCAC No data
Right 1197635846 X:128914123-128914145 AAGGTGAGCTCACTATAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197635846 Original CRISPR AAGGTGAGCTCACTATAGGT TGG Intergenic
No off target data available for this crispr