ID: 1197636389

View in Genome Browser
Species Human (GRCh38)
Location X:128919499-128919521
Sequence CATTATATGGGGAAATGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197636384_1197636389 -10 Left 1197636384 X:128919486-128919508 CCTTTTGAAGATTCATTATATGG No data
Right 1197636389 X:128919499-128919521 CATTATATGGGGAAATGGAAAGG No data
1197636383_1197636389 -9 Left 1197636383 X:128919485-128919507 CCCTTTTGAAGATTCATTATATG No data
Right 1197636389 X:128919499-128919521 CATTATATGGGGAAATGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197636389 Original CRISPR CATTATATGGGGAAATGGAA AGG Intergenic
No off target data available for this crispr