ID: 1197645152

View in Genome Browser
Species Human (GRCh38)
Location X:129009495-129009517
Sequence CAGATTTAGGAGAAGGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197645152_1197645165 16 Left 1197645152 X:129009495-129009517 CCAGTCCCCTTCTCCTAAATCTG No data
Right 1197645165 X:129009534-129009556 AACAGGCATATAACCAAAGTGGG No data
1197645152_1197645157 -1 Left 1197645152 X:129009495-129009517 CCAGTCCCCTTCTCCTAAATCTG No data
Right 1197645157 X:129009517-129009539 GTCCCCCTCCCAGATACAACAGG No data
1197645152_1197645164 15 Left 1197645152 X:129009495-129009517 CCAGTCCCCTTCTCCTAAATCTG No data
Right 1197645164 X:129009533-129009555 CAACAGGCATATAACCAAAGTGG No data
1197645152_1197645166 19 Left 1197645152 X:129009495-129009517 CCAGTCCCCTTCTCCTAAATCTG No data
Right 1197645166 X:129009537-129009559 AGGCATATAACCAAAGTGGGTGG No data
1197645152_1197645167 25 Left 1197645152 X:129009495-129009517 CCAGTCCCCTTCTCCTAAATCTG No data
Right 1197645167 X:129009543-129009565 ATAACCAAAGTGGGTGGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197645152 Original CRISPR CAGATTTAGGAGAAGGGGAC TGG (reversed) Intergenic
No off target data available for this crispr