ID: 1197645157

View in Genome Browser
Species Human (GRCh38)
Location X:129009517-129009539
Sequence GTCCCCCTCCCAGATACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197645153_1197645157 -6 Left 1197645153 X:129009500-129009522 CCCCTTCTCCTAAATCTGTCCCC No data
Right 1197645157 X:129009517-129009539 GTCCCCCTCCCAGATACAACAGG No data
1197645151_1197645157 7 Left 1197645151 X:129009487-129009509 CCACTTCTCCAGTCCCCTTCTCC No data
Right 1197645157 X:129009517-129009539 GTCCCCCTCCCAGATACAACAGG No data
1197645152_1197645157 -1 Left 1197645152 X:129009495-129009517 CCAGTCCCCTTCTCCTAAATCTG No data
Right 1197645157 X:129009517-129009539 GTCCCCCTCCCAGATACAACAGG No data
1197645154_1197645157 -7 Left 1197645154 X:129009501-129009523 CCCTTCTCCTAAATCTGTCCCCC No data
Right 1197645157 X:129009517-129009539 GTCCCCCTCCCAGATACAACAGG No data
1197645155_1197645157 -8 Left 1197645155 X:129009502-129009524 CCTTCTCCTAAATCTGTCCCCCT No data
Right 1197645157 X:129009517-129009539 GTCCCCCTCCCAGATACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197645157 Original CRISPR GTCCCCCTCCCAGATACAAC AGG Intergenic
No off target data available for this crispr