ID: 1197645164

View in Genome Browser
Species Human (GRCh38)
Location X:129009533-129009555
Sequence CAACAGGCATATAACCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197645151_1197645164 23 Left 1197645151 X:129009487-129009509 CCACTTCTCCAGTCCCCTTCTCC No data
Right 1197645164 X:129009533-129009555 CAACAGGCATATAACCAAAGTGG No data
1197645154_1197645164 9 Left 1197645154 X:129009501-129009523 CCCTTCTCCTAAATCTGTCCCCC No data
Right 1197645164 X:129009533-129009555 CAACAGGCATATAACCAAAGTGG No data
1197645152_1197645164 15 Left 1197645152 X:129009495-129009517 CCAGTCCCCTTCTCCTAAATCTG No data
Right 1197645164 X:129009533-129009555 CAACAGGCATATAACCAAAGTGG No data
1197645156_1197645164 2 Left 1197645156 X:129009508-129009530 CCTAAATCTGTCCCCCTCCCAGA No data
Right 1197645164 X:129009533-129009555 CAACAGGCATATAACCAAAGTGG No data
1197645153_1197645164 10 Left 1197645153 X:129009500-129009522 CCCCTTCTCCTAAATCTGTCCCC No data
Right 1197645164 X:129009533-129009555 CAACAGGCATATAACCAAAGTGG No data
1197645159_1197645164 -10 Left 1197645159 X:129009520-129009542 CCCCTCCCAGATACAACAGGCAT No data
Right 1197645164 X:129009533-129009555 CAACAGGCATATAACCAAAGTGG No data
1197645155_1197645164 8 Left 1197645155 X:129009502-129009524 CCTTCTCCTAAATCTGTCCCCCT No data
Right 1197645164 X:129009533-129009555 CAACAGGCATATAACCAAAGTGG No data
1197645158_1197645164 -9 Left 1197645158 X:129009519-129009541 CCCCCTCCCAGATACAACAGGCA No data
Right 1197645164 X:129009533-129009555 CAACAGGCATATAACCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197645164 Original CRISPR CAACAGGCATATAACCAAAG TGG Intergenic
No off target data available for this crispr