ID: 1197645167

View in Genome Browser
Species Human (GRCh38)
Location X:129009543-129009565
Sequence ATAACCAAAGTGGGTGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197645158_1197645167 1 Left 1197645158 X:129009519-129009541 CCCCCTCCCAGATACAACAGGCA No data
Right 1197645167 X:129009543-129009565 ATAACCAAAGTGGGTGGTAGTGG No data
1197645152_1197645167 25 Left 1197645152 X:129009495-129009517 CCAGTCCCCTTCTCCTAAATCTG No data
Right 1197645167 X:129009543-129009565 ATAACCAAAGTGGGTGGTAGTGG No data
1197645159_1197645167 0 Left 1197645159 X:129009520-129009542 CCCCTCCCAGATACAACAGGCAT No data
Right 1197645167 X:129009543-129009565 ATAACCAAAGTGGGTGGTAGTGG No data
1197645160_1197645167 -1 Left 1197645160 X:129009521-129009543 CCCTCCCAGATACAACAGGCATA No data
Right 1197645167 X:129009543-129009565 ATAACCAAAGTGGGTGGTAGTGG No data
1197645155_1197645167 18 Left 1197645155 X:129009502-129009524 CCTTCTCCTAAATCTGTCCCCCT No data
Right 1197645167 X:129009543-129009565 ATAACCAAAGTGGGTGGTAGTGG No data
1197645163_1197645167 -6 Left 1197645163 X:129009526-129009548 CCAGATACAACAGGCATATAACC No data
Right 1197645167 X:129009543-129009565 ATAACCAAAGTGGGTGGTAGTGG No data
1197645156_1197645167 12 Left 1197645156 X:129009508-129009530 CCTAAATCTGTCCCCCTCCCAGA No data
Right 1197645167 X:129009543-129009565 ATAACCAAAGTGGGTGGTAGTGG No data
1197645153_1197645167 20 Left 1197645153 X:129009500-129009522 CCCCTTCTCCTAAATCTGTCCCC No data
Right 1197645167 X:129009543-129009565 ATAACCAAAGTGGGTGGTAGTGG No data
1197645162_1197645167 -5 Left 1197645162 X:129009525-129009547 CCCAGATACAACAGGCATATAAC No data
Right 1197645167 X:129009543-129009565 ATAACCAAAGTGGGTGGTAGTGG No data
1197645161_1197645167 -2 Left 1197645161 X:129009522-129009544 CCTCCCAGATACAACAGGCATAT No data
Right 1197645167 X:129009543-129009565 ATAACCAAAGTGGGTGGTAGTGG No data
1197645154_1197645167 19 Left 1197645154 X:129009501-129009523 CCCTTCTCCTAAATCTGTCCCCC No data
Right 1197645167 X:129009543-129009565 ATAACCAAAGTGGGTGGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197645167 Original CRISPR ATAACCAAAGTGGGTGGTAG TGG Intergenic
No off target data available for this crispr