ID: 1197645766

View in Genome Browser
Species Human (GRCh38)
Location X:129015124-129015146
Sequence CAGAAGAAGCAGCAAGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197645766_1197645772 18 Left 1197645766 X:129015124-129015146 CCATCTTCTTGCTGCTTCTTCTG No data
Right 1197645772 X:129015165-129015187 AGCCCTAAAAAGTAAATAAAAGG No data
1197645766_1197645775 28 Left 1197645766 X:129015124-129015146 CCATCTTCTTGCTGCTTCTTCTG No data
Right 1197645775 X:129015175-129015197 AGTAAATAAAAGGTCCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197645766 Original CRISPR CAGAAGAAGCAGCAAGAAGA TGG (reversed) Intergenic
No off target data available for this crispr