ID: 1197645772

View in Genome Browser
Species Human (GRCh38)
Location X:129015165-129015187
Sequence AGCCCTAAAAAGTAAATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197645766_1197645772 18 Left 1197645766 X:129015124-129015146 CCATCTTCTTGCTGCTTCTTCTG No data
Right 1197645772 X:129015165-129015187 AGCCCTAAAAAGTAAATAAAAGG No data
1197645771_1197645772 -9 Left 1197645771 X:129015151-129015173 CCAGTGGGAAGTAGAGCCCTAAA No data
Right 1197645772 X:129015165-129015187 AGCCCTAAAAAGTAAATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197645772 Original CRISPR AGCCCTAAAAAGTAAATAAA AGG Intergenic
No off target data available for this crispr