ID: 1197647706

View in Genome Browser
Species Human (GRCh38)
Location X:129036027-129036049
Sequence CTGAGACAAGCACCAGTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197647706_1197647708 -8 Left 1197647706 X:129036027-129036049 CCTGTAACTGGTGCTTGTCTCAG No data
Right 1197647708 X:129036042-129036064 TGTCTCAGTGGACCACATGCTGG No data
1197647706_1197647710 4 Left 1197647706 X:129036027-129036049 CCTGTAACTGGTGCTTGTCTCAG No data
Right 1197647710 X:129036054-129036076 CCACATGCTGGAATTGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197647706 Original CRISPR CTGAGACAAGCACCAGTTAC AGG (reversed) Intergenic
No off target data available for this crispr