ID: 1197647708

View in Genome Browser
Species Human (GRCh38)
Location X:129036042-129036064
Sequence TGTCTCAGTGGACCACATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197647706_1197647708 -8 Left 1197647706 X:129036027-129036049 CCTGTAACTGGTGCTTGTCTCAG No data
Right 1197647708 X:129036042-129036064 TGTCTCAGTGGACCACATGCTGG No data
1197647705_1197647708 3 Left 1197647705 X:129036016-129036038 CCATGACTGCTCCTGTAACTGGT No data
Right 1197647708 X:129036042-129036064 TGTCTCAGTGGACCACATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197647708 Original CRISPR TGTCTCAGTGGACCACATGC TGG Intergenic
No off target data available for this crispr