ID: 1197653853

View in Genome Browser
Species Human (GRCh38)
Location X:129094606-129094628
Sequence AGATCTATGCCACTTGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197653846_1197653853 15 Left 1197653846 X:129094568-129094590 CCATCAACTGACCCCTGAACTCT No data
Right 1197653853 X:129094606-129094628 AGATCTATGCCACTTGTCACTGG No data
1197653851_1197653853 -10 Left 1197653851 X:129094593-129094615 CCACTCACCTCACAGATCTATGC No data
Right 1197653853 X:129094606-129094628 AGATCTATGCCACTTGTCACTGG No data
1197653845_1197653853 21 Left 1197653845 X:129094562-129094584 CCGCTGCCATCAACTGACCCCTG No data
Right 1197653853 X:129094606-129094628 AGATCTATGCCACTTGTCACTGG No data
1197653848_1197653853 4 Left 1197653848 X:129094579-129094601 CCCCTGAACTCTGGCCACTCACC No data
Right 1197653853 X:129094606-129094628 AGATCTATGCCACTTGTCACTGG No data
1197653849_1197653853 3 Left 1197653849 X:129094580-129094602 CCCTGAACTCTGGCCACTCACCT No data
Right 1197653853 X:129094606-129094628 AGATCTATGCCACTTGTCACTGG No data
1197653850_1197653853 2 Left 1197653850 X:129094581-129094603 CCTGAACTCTGGCCACTCACCTC No data
Right 1197653853 X:129094606-129094628 AGATCTATGCCACTTGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197653853 Original CRISPR AGATCTATGCCACTTGTCAC TGG Intergenic