ID: 1197664559

View in Genome Browser
Species Human (GRCh38)
Location X:129210129-129210151
Sequence CTGTTCTGGTAGAGGTGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197664551_1197664559 12 Left 1197664551 X:129210094-129210116 CCATCTGTGGTTCTCTAAGCCAT No data
Right 1197664559 X:129210129-129210151 CTGTTCTGGTAGAGGTGTCAGGG No data
1197664553_1197664559 -7 Left 1197664553 X:129210113-129210135 CCATGGATACCAGCACCTGTTCT 0: 40
1: 164
2: 286
3: 289
4: 335
Right 1197664559 X:129210129-129210151 CTGTTCTGGTAGAGGTGTCAGGG No data
1197664549_1197664559 25 Left 1197664549 X:129210081-129210103 CCTGTGATGTGCACCATCTGTGG No data
Right 1197664559 X:129210129-129210151 CTGTTCTGGTAGAGGTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197664559 Original CRISPR CTGTTCTGGTAGAGGTGTCA GGG Intergenic
No off target data available for this crispr