ID: 1197665547

View in Genome Browser
Species Human (GRCh38)
Location X:129219495-129219517
Sequence GGAGTTGCAATTGAAGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197665546_1197665547 -4 Left 1197665546 X:129219476-129219498 CCTACATTATTATTTAGTAGGAG No data
Right 1197665547 X:129219495-129219517 GGAGTTGCAATTGAAGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197665547 Original CRISPR GGAGTTGCAATTGAAGAGTC TGG Intergenic
No off target data available for this crispr