ID: 1197666850

View in Genome Browser
Species Human (GRCh38)
Location X:129233523-129233545
Sequence CATCATAGTTGAAGAAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197666850_1197666853 3 Left 1197666850 X:129233523-129233545 CCCATTCTTCTTCAACTATGATG No data
Right 1197666853 X:129233549-129233571 CAGAAATCAGATGCTTCTTGAGG No data
1197666850_1197666854 4 Left 1197666850 X:129233523-129233545 CCCATTCTTCTTCAACTATGATG No data
Right 1197666854 X:129233550-129233572 AGAAATCAGATGCTTCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197666850 Original CRISPR CATCATAGTTGAAGAAGAAT GGG (reversed) Intergenic
No off target data available for this crispr