ID: 1197670702

View in Genome Browser
Species Human (GRCh38)
Location X:129273798-129273820
Sequence AGGGAAAGCACAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197670702_1197670706 24 Left 1197670702 X:129273798-129273820 CCCACAATCACTGTGCTTTCCCT No data
Right 1197670706 X:129273845-129273867 CAGTGCCACATAGCCACTGCTGG No data
1197670702_1197670707 27 Left 1197670702 X:129273798-129273820 CCCACAATCACTGTGCTTTCCCT No data
Right 1197670707 X:129273848-129273870 TGCCACATAGCCACTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197670702 Original CRISPR AGGGAAAGCACAGTGATTGT GGG (reversed) Intergenic