ID: 1197670706

View in Genome Browser
Species Human (GRCh38)
Location X:129273845-129273867
Sequence CAGTGCCACATAGCCACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197670705_1197670706 4 Left 1197670705 X:129273818-129273840 CCTCTCTCAAGCACAGAGATTCT No data
Right 1197670706 X:129273845-129273867 CAGTGCCACATAGCCACTGCTGG No data
1197670702_1197670706 24 Left 1197670702 X:129273798-129273820 CCCACAATCACTGTGCTTTCCCT No data
Right 1197670706 X:129273845-129273867 CAGTGCCACATAGCCACTGCTGG No data
1197670704_1197670706 5 Left 1197670704 X:129273817-129273839 CCCTCTCTCAAGCACAGAGATTC No data
Right 1197670706 X:129273845-129273867 CAGTGCCACATAGCCACTGCTGG No data
1197670703_1197670706 23 Left 1197670703 X:129273799-129273821 CCACAATCACTGTGCTTTCCCTC No data
Right 1197670706 X:129273845-129273867 CAGTGCCACATAGCCACTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197670706 Original CRISPR CAGTGCCACATAGCCACTGC TGG Intergenic
No off target data available for this crispr