ID: 1197674465 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | X:129314542-129314564 |
Sequence | GATTCACTTATTATGCTGTC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1197674465_1197674468 | 11 | Left | 1197674465 | X:129314542-129314564 | CCTGACAGCATAATAAGTGAATC | No data | ||
Right | 1197674468 | X:129314576-129314598 | CTAGGCTACAGATCCTTTCTTGG | No data | ||||
1197674465_1197674469 | 15 | Left | 1197674465 | X:129314542-129314564 | CCTGACAGCATAATAAGTGAATC | No data | ||
Right | 1197674469 | X:129314580-129314602 | GCTACAGATCCTTTCTTGGATGG | No data | ||||
1197674465_1197674466 | -7 | Left | 1197674465 | X:129314542-129314564 | CCTGACAGCATAATAAGTGAATC | No data | ||
Right | 1197674466 | X:129314558-129314580 | GTGAATCTGTTATATATCCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1197674465 | Original CRISPR | GATTCACTTATTATGCTGTC AGG (reversed) | Intergenic | ||