ID: 1197674465

View in Genome Browser
Species Human (GRCh38)
Location X:129314542-129314564
Sequence GATTCACTTATTATGCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197674465_1197674468 11 Left 1197674465 X:129314542-129314564 CCTGACAGCATAATAAGTGAATC No data
Right 1197674468 X:129314576-129314598 CTAGGCTACAGATCCTTTCTTGG No data
1197674465_1197674469 15 Left 1197674465 X:129314542-129314564 CCTGACAGCATAATAAGTGAATC No data
Right 1197674469 X:129314580-129314602 GCTACAGATCCTTTCTTGGATGG No data
1197674465_1197674466 -7 Left 1197674465 X:129314542-129314564 CCTGACAGCATAATAAGTGAATC No data
Right 1197674466 X:129314558-129314580 GTGAATCTGTTATATATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197674465 Original CRISPR GATTCACTTATTATGCTGTC AGG (reversed) Intergenic