ID: 1197674466

View in Genome Browser
Species Human (GRCh38)
Location X:129314558-129314580
Sequence GTGAATCTGTTATATATCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197674465_1197674466 -7 Left 1197674465 X:129314542-129314564 CCTGACAGCATAATAAGTGAATC No data
Right 1197674466 X:129314558-129314580 GTGAATCTGTTATATATCCTAGG No data
1197674464_1197674466 3 Left 1197674464 X:129314532-129314554 CCTCAGGCGTCCTGACAGCATAA No data
Right 1197674466 X:129314558-129314580 GTGAATCTGTTATATATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197674466 Original CRISPR GTGAATCTGTTATATATCCT AGG Intergenic
No off target data available for this crispr