ID: 1197674469

View in Genome Browser
Species Human (GRCh38)
Location X:129314580-129314602
Sequence GCTACAGATCCTTTCTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197674464_1197674469 25 Left 1197674464 X:129314532-129314554 CCTCAGGCGTCCTGACAGCATAA No data
Right 1197674469 X:129314580-129314602 GCTACAGATCCTTTCTTGGATGG No data
1197674465_1197674469 15 Left 1197674465 X:129314542-129314564 CCTGACAGCATAATAAGTGAATC No data
Right 1197674469 X:129314580-129314602 GCTACAGATCCTTTCTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197674469 Original CRISPR GCTACAGATCCTTTCTTGGA TGG Intergenic
No off target data available for this crispr