ID: 1197674469 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:129314580-129314602 |
| Sequence | GCTACAGATCCTTTCTTGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1197674464_1197674469 | 25 | Left | 1197674464 | X:129314532-129314554 | CCTCAGGCGTCCTGACAGCATAA | No data | ||
| Right | 1197674469 | X:129314580-129314602 | GCTACAGATCCTTTCTTGGATGG | No data | ||||
| 1197674465_1197674469 | 15 | Left | 1197674465 | X:129314542-129314564 | CCTGACAGCATAATAAGTGAATC | No data | ||
| Right | 1197674469 | X:129314580-129314602 | GCTACAGATCCTTTCTTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1197674469 | Original CRISPR | GCTACAGATCCTTTCTTGGA TGG | Intergenic | ||