ID: 1197679524

View in Genome Browser
Species Human (GRCh38)
Location X:129367327-129367349
Sequence CAGGGTAGACCATCGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197679519_1197679524 -8 Left 1197679519 X:129367312-129367334 CCATGTGAAAAAGCCCAGGGTAG No data
Right 1197679524 X:129367327-129367349 CAGGGTAGACCATCGGAGGAAGG No data
1197679516_1197679524 3 Left 1197679516 X:129367301-129367323 CCTTGTCAGGACCATGTGAAAAA No data
Right 1197679524 X:129367327-129367349 CAGGGTAGACCATCGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197679524 Original CRISPR CAGGGTAGACCATCGGAGGA AGG Intergenic
No off target data available for this crispr