ID: 1197685844

View in Genome Browser
Species Human (GRCh38)
Location X:129438730-129438752
Sequence GGTTGGGCTCAGCACCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197685844_1197685852 14 Left 1197685844 X:129438730-129438752 CCCATGAGGTGCTGAGCCCAACC No data
Right 1197685852 X:129438767-129438789 ACAGAATTGTGAGTTGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197685844 Original CRISPR GGTTGGGCTCAGCACCTCAT GGG (reversed) Intergenic
No off target data available for this crispr