ID: 1197700107

View in Genome Browser
Species Human (GRCh38)
Location X:129593284-129593306
Sequence CTGAGTCAGCACATTCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197700107_1197700115 29 Left 1197700107 X:129593284-129593306 CCCTGATGAATGTGCTGACTCAG No data
Right 1197700115 X:129593336-129593358 CCCAAAGCCTTGGCAGGAGAAGG No data
1197700107_1197700109 19 Left 1197700107 X:129593284-129593306 CCCTGATGAATGTGCTGACTCAG No data
Right 1197700109 X:129593326-129593348 CAAAGCCCCACCCAAAGCCTTGG No data
1197700107_1197700110 23 Left 1197700107 X:129593284-129593306 CCCTGATGAATGTGCTGACTCAG No data
Right 1197700110 X:129593330-129593352 GCCCCACCCAAAGCCTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197700107 Original CRISPR CTGAGTCAGCACATTCATCA GGG (reversed) Intergenic
No off target data available for this crispr