ID: 1197703849

View in Genome Browser
Species Human (GRCh38)
Location X:129619549-129619571
Sequence CTTTGGCCAGGAAGGAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197703849_1197703855 28 Left 1197703849 X:129619549-129619571 CCTTCTTTCCTTCCTGGCCAAAG No data
Right 1197703855 X:129619600-129619622 GTCAGATCCATCATCCATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197703849 Original CRISPR CTTTGGCCAGGAAGGAAAGA AGG (reversed) Intergenic
No off target data available for this crispr