ID: 1197704064

View in Genome Browser
Species Human (GRCh38)
Location X:129621381-129621403
Sequence CCATAGCCACATGTGGCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197704061_1197704064 -7 Left 1197704061 X:129621365-129621387 CCACGTTTCAAGTGCTCCATAGC No data
Right 1197704064 X:129621381-129621403 CCATAGCCACATGTGGCTCATGG No data
1197704058_1197704064 22 Left 1197704058 X:129621336-129621358 CCCTTGGAGAACATTCTGTTTTG No data
Right 1197704064 X:129621381-129621403 CCATAGCCACATGTGGCTCATGG No data
1197704059_1197704064 21 Left 1197704059 X:129621337-129621359 CCTTGGAGAACATTCTGTTTTGT No data
Right 1197704064 X:129621381-129621403 CCATAGCCACATGTGGCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197704064 Original CRISPR CCATAGCCACATGTGGCTCA TGG Intergenic
No off target data available for this crispr