ID: 1197706022

View in Genome Browser
Species Human (GRCh38)
Location X:129635022-129635044
Sequence CCTGACAAGCAGCATTTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197706022_1197706026 25 Left 1197706022 X:129635022-129635044 CCATGGAAATGCTGCTTGTCAGG No data
Right 1197706026 X:129635070-129635092 CTCTTCCAGGAGACTGAGGCTGG No data
1197706022_1197706025 21 Left 1197706022 X:129635022-129635044 CCATGGAAATGCTGCTTGTCAGG No data
Right 1197706025 X:129635066-129635088 CTAACTCTTCCAGGAGACTGAGG No data
1197706022_1197706024 12 Left 1197706022 X:129635022-129635044 CCATGGAAATGCTGCTTGTCAGG No data
Right 1197706024 X:129635057-129635079 AGTGCAAAACTAACTCTTCCAGG No data
1197706022_1197706027 29 Left 1197706022 X:129635022-129635044 CCATGGAAATGCTGCTTGTCAGG No data
Right 1197706027 X:129635074-129635096 TCCAGGAGACTGAGGCTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197706022 Original CRISPR CCTGACAAGCAGCATTTCCA TGG (reversed) Intergenic
No off target data available for this crispr