ID: 1197706224

View in Genome Browser
Species Human (GRCh38)
Location X:129636511-129636533
Sequence CTGAGTGAGCTCAGAGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197706224_1197706230 6 Left 1197706224 X:129636511-129636533 CCCATCCCTCTGAGCTCACTCAG No data
Right 1197706230 X:129636540-129636562 TTCCCTTTGGGCAAAGTCCAAGG No data
1197706224_1197706235 9 Left 1197706224 X:129636511-129636533 CCCATCCCTCTGAGCTCACTCAG No data
Right 1197706235 X:129636543-129636565 CCTTTGGGCAAAGTCCAAGGGGG No data
1197706224_1197706231 7 Left 1197706224 X:129636511-129636533 CCCATCCCTCTGAGCTCACTCAG No data
Right 1197706231 X:129636541-129636563 TCCCTTTGGGCAAAGTCCAAGGG No data
1197706224_1197706229 -6 Left 1197706224 X:129636511-129636533 CCCATCCCTCTGAGCTCACTCAG No data
Right 1197706229 X:129636528-129636550 ACTCAGAAAGCTTTCCCTTTGGG No data
1197706224_1197706233 8 Left 1197706224 X:129636511-129636533 CCCATCCCTCTGAGCTCACTCAG No data
Right 1197706233 X:129636542-129636564 CCCTTTGGGCAAAGTCCAAGGGG No data
1197706224_1197706228 -7 Left 1197706224 X:129636511-129636533 CCCATCCCTCTGAGCTCACTCAG No data
Right 1197706228 X:129636527-129636549 CACTCAGAAAGCTTTCCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197706224 Original CRISPR CTGAGTGAGCTCAGAGGGAT GGG (reversed) Intergenic