ID: 1197706229

View in Genome Browser
Species Human (GRCh38)
Location X:129636528-129636550
Sequence ACTCAGAAAGCTTTCCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197706222_1197706229 5 Left 1197706222 X:129636500-129636522 CCTCCAGAGCTCCCATCCCTCTG No data
Right 1197706229 X:129636528-129636550 ACTCAGAAAGCTTTCCCTTTGGG No data
1197706224_1197706229 -6 Left 1197706224 X:129636511-129636533 CCCATCCCTCTGAGCTCACTCAG No data
Right 1197706229 X:129636528-129636550 ACTCAGAAAGCTTTCCCTTTGGG No data
1197706225_1197706229 -7 Left 1197706225 X:129636512-129636534 CCATCCCTCTGAGCTCACTCAGA No data
Right 1197706229 X:129636528-129636550 ACTCAGAAAGCTTTCCCTTTGGG No data
1197706223_1197706229 2 Left 1197706223 X:129636503-129636525 CCAGAGCTCCCATCCCTCTGAGC No data
Right 1197706229 X:129636528-129636550 ACTCAGAAAGCTTTCCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197706229 Original CRISPR ACTCAGAAAGCTTTCCCTTT GGG Intergenic