ID: 1197707957

View in Genome Browser
Species Human (GRCh38)
Location X:129647574-129647596
Sequence AAGGCCCAAATGAAGGTTTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197707943_1197707957 28 Left 1197707943 X:129647523-129647545 CCCACAGAAGGGAGCACTTCCAC 0: 1
1: 0
2: 0
3: 17
4: 127
Right 1197707957 X:129647574-129647596 AAGGCCCAAATGAAGGTTTGGGG 0: 1
1: 0
2: 1
3: 15
4: 193
1197707944_1197707957 27 Left 1197707944 X:129647524-129647546 CCACAGAAGGGAGCACTTCCACC 0: 1
1: 0
2: 1
3: 22
4: 150
Right 1197707957 X:129647574-129647596 AAGGCCCAAATGAAGGTTTGGGG 0: 1
1: 0
2: 1
3: 15
4: 193
1197707948_1197707957 6 Left 1197707948 X:129647545-129647567 CCCCGCGCTCAGGGCAGACATGA 0: 1
1: 0
2: 0
3: 2
4: 95
Right 1197707957 X:129647574-129647596 AAGGCCCAAATGAAGGTTTGGGG 0: 1
1: 0
2: 1
3: 15
4: 193
1197707949_1197707957 5 Left 1197707949 X:129647546-129647568 CCCGCGCTCAGGGCAGACATGAG 0: 1
1: 0
2: 2
3: 10
4: 176
Right 1197707957 X:129647574-129647596 AAGGCCCAAATGAAGGTTTGGGG 0: 1
1: 0
2: 1
3: 15
4: 193
1197707947_1197707957 9 Left 1197707947 X:129647542-129647564 CCACCCCGCGCTCAGGGCAGACA 0: 1
1: 0
2: 0
3: 15
4: 141
Right 1197707957 X:129647574-129647596 AAGGCCCAAATGAAGGTTTGGGG 0: 1
1: 0
2: 1
3: 15
4: 193
1197707950_1197707957 4 Left 1197707950 X:129647547-129647569 CCGCGCTCAGGGCAGACATGAGG 0: 1
1: 0
2: 2
3: 16
4: 214
Right 1197707957 X:129647574-129647596 AAGGCCCAAATGAAGGTTTGGGG 0: 1
1: 0
2: 1
3: 15
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197707957 Original CRISPR AAGGCCCAAATGAAGGTTTG GGG Exonic
900919038 1:5659144-5659166 TGGGCCCAAGTGAAGGGTTGTGG - Intergenic
901072451 1:6528452-6528474 AAGTACCAAATGAAGGCTAGGGG + Intronic
904592893 1:31625193-31625215 AGGGCCCAAATAAAGGATGGTGG + Intronic
904624201 1:31793042-31793064 AGGGCCCAAAGGAGGGTTTTAGG - Intronic
905105273 1:35560082-35560104 AATGCTCAAATGAATGGTTGAGG + Intronic
908058687 1:60322635-60322657 AAGTCCCACATAAATGTTTGTGG - Intergenic
908664005 1:66469066-66469088 CAGGACCAAATCAAGCTTTGTGG + Intergenic
910382285 1:86641220-86641242 AAGACCCTAATGAAAGTTTCTGG + Intergenic
910528591 1:88210109-88210131 ATGCCCCAGATGAAGTTTTGTGG - Intergenic
911626367 1:100129499-100129521 AAGGCCCAAATAATGGTTTAAGG + Intronic
912802665 1:112730277-112730299 AAGGAGGAAATGAAGGCTTGAGG - Intergenic
913288805 1:117252950-117252972 ATGGAACAAATGAAGTTTTGAGG - Intergenic
913692345 1:121291065-121291087 AAGGCCAGGATGAAGGTTTTGGG + Intronic
914853785 1:151335103-151335125 AAGGCCTAAACTAAGATTTGGGG - Intergenic
916749844 1:167714155-167714177 TATCCCCAAATGAAGGTTCGGGG + Intergenic
918026214 1:180749910-180749932 AAAGGGCAAATGAAGGGTTGAGG + Intronic
919814098 1:201426847-201426869 CAGCCCCACATGAAGGTTTGTGG + Intronic
920479666 1:206309418-206309440 AAGGCCAGGATGAAGGTTTTGGG + Intronic
920971731 1:210748875-210748897 AAGGGCCAAGTGGAGGTTTCAGG - Intronic
921511205 1:216032913-216032935 AAGGCCAAAATCAAGAGTTGGGG - Intronic
921839473 1:219813016-219813038 AAGGTCCAAATGGAGGTAGGAGG + Intronic
922192164 1:223328885-223328907 CAGGCCAAAATTAAAGTTTGTGG - Intronic
924041582 1:239989171-239989193 AAGGCCCAAGTAAAGGTTCCTGG + Intergenic
1063241653 10:4175812-4175834 CAGGCCCACATGGAGGTCTGTGG - Intergenic
1063352164 10:5365679-5365701 ATGGCACAGGTGAAGGTTTGTGG - Intronic
1063863229 10:10335156-10335178 AAGGACCAAACGAAGCTTTCAGG + Intergenic
1065916664 10:30358857-30358879 AAGTCACAGATGAAGCTTTGGGG - Intronic
1067218628 10:44324737-44324759 AAGGCAGAAATGAAGGTGTCAGG - Intergenic
1067565858 10:47336323-47336345 GAGGAACAAATGAAGGTTTCAGG - Intergenic
1068842671 10:61632606-61632628 AAGCCCCAAATGAAGGCTTTTGG - Intergenic
1071292537 10:84197913-84197935 AAAGCCCCCATGAAGGCTTGGGG - Intronic
1072030349 10:91515103-91515125 AAGGGCCAAATGAATGGTTTTGG - Intergenic
1075861501 10:125680789-125680811 AAGGCCCAAGCCAAGCTTTGGGG + Intronic
1075992511 10:126849946-126849968 AAGGAACAAATGAAGTCTTGAGG + Intergenic
1079801385 11:24874138-24874160 AATGCTAAAATGAAGGTTTTTGG + Intronic
1080645643 11:34185840-34185862 AAAGCACTGATGAAGGTTTGAGG + Intronic
1084270916 11:68028714-68028736 AAGGATGAAATGAAGGATTGAGG + Exonic
1087403555 11:97699520-97699542 GAGGCCCAAATGAAGGCAAGGGG - Intergenic
1088880831 11:113972105-113972127 AATGCAGAAATGAAGGCTTGGGG + Intergenic
1089039220 11:115430346-115430368 AAGTAACAAATGAAGTTTTGAGG - Intronic
1089850080 11:121488147-121488169 AAAGCCCAAGAGAAGGTTGGAGG - Exonic
1090309352 11:125721115-125721137 AAGGGTCAAAGGAAGCTTTGAGG - Intergenic
1091112732 11:132985256-132985278 CAGGCCAAAATCAAGGTCTGGGG + Intronic
1091461164 12:644229-644251 CAGGCCCACATTTAGGTTTGAGG - Intronic
1092069683 12:5622549-5622571 AGGGAACAAATGAAGGTTTGAGG + Intronic
1095804292 12:46301599-46301621 AAGGCCAAAATGAAAATTTTTGG - Intergenic
1096857122 12:54491804-54491826 CTGGCCAAAATGAGGGTTTGGGG - Intergenic
1097178800 12:57159181-57159203 GAGGCCCAAGTGCAGATTTGGGG - Intronic
1098600174 12:72322097-72322119 AACCCCCAAATCAATGTTTGTGG + Intronic
1098718616 12:73865579-73865601 GAGACCCTAATTAAGGTTTGTGG - Intergenic
1099275908 12:80575949-80575971 AAGGCTCAAAGGATGGTGTGAGG - Intronic
1108207088 13:48101335-48101357 AAGGACCCACTGAAGATTTGGGG - Intergenic
1109329348 13:60908861-60908883 ATGGCCCAGATGAATGGTTGTGG - Intergenic
1110292080 13:73818995-73819017 AAGGGAAAAATGAATGTTTGGGG + Intronic
1110730072 13:78870101-78870123 TAGCCACAAATGAAAGTTTGTGG + Intergenic
1111279234 13:85997592-85997614 AAGGCTCAAATGATGGTGGGGGG + Intergenic
1112033019 13:95474493-95474515 AAGTCTCAAATGGAGGTTAGAGG + Intronic
1112482829 13:99792643-99792665 AAGGCCTAAAAGAAGGTGAGTGG + Intronic
1112753240 13:102603104-102603126 ATGGCTCAAATGAAAATTTGTGG + Intronic
1113518303 13:110919910-110919932 AAGGCCCAGATGGAGGTGTCAGG - Intergenic
1117981914 14:61350050-61350072 AATGCCCCAAAGAAGGTTTATGG + Intronic
1118467640 14:66045359-66045381 AAGGCCCAAGTGAACATCTGGGG + Intergenic
1119573542 14:75697683-75697705 TAGGCCCAAATGCAGGGTGGAGG + Intronic
1121379876 14:93455193-93455215 AAGACATAAATGAAGGGTTGTGG - Intronic
1123671930 15:22667239-22667261 AGGACCCAAAAGAAGGTTTGAGG - Intergenic
1124323977 15:28740451-28740473 AGGACCCAAAAGAAGGTTTGAGG - Intergenic
1124527861 15:30473694-30473716 AGGACCCAAAAGAAGGTTTGAGG - Intergenic
1124770797 15:32534008-32534030 AGGACCCAAAAGAAGGTTTGAGG + Intergenic
1126342154 15:47652720-47652742 AAGGTCCAAAGGAAGGTTCAAGG + Intronic
1129107734 15:73320870-73320892 AAGGGCCCAAGGAAGGTGTGTGG - Exonic
1130317985 15:82812604-82812626 GGGACCCAAAAGAAGGTTTGAGG - Intronic
1133195777 16:4169185-4169207 AAGGCTGAAATCAAGGTGTGAGG - Intergenic
1133245312 16:4444743-4444765 AAGGCCCAACAGAAGCTGTGCGG - Intronic
1134881760 16:17750922-17750944 GAGCCCCAAATCCAGGTTTGTGG - Intergenic
1138740393 16:59302300-59302322 AAGGCCACAGTGAGGGTTTGGGG - Intergenic
1141307490 16:82879380-82879402 AAGGCTCAAAGTGAGGTTTGAGG - Intronic
1143175281 17:4951543-4951565 AAGGCCTAAGTGGAGGCTTGGGG + Intronic
1143978284 17:10846344-10846366 AAGAAACAAATGAAGGTTGGTGG + Intergenic
1146530813 17:33606389-33606411 AAGGTCCAAATAAAGCTGTGTGG - Intronic
1146654047 17:34624985-34625007 AGGACCCAAACGGAGGTTTGAGG - Intronic
1147371977 17:39998571-39998593 AAGGACAAATTGAAGGTTTCTGG + Intergenic
1150127142 17:62644745-62644767 AAGTCCCAAATGAGGATCTGCGG - Intronic
1152022975 17:77790747-77790769 CAGGCCCAGGTGAAGGTGTGGGG + Intergenic
1155734759 18:29207829-29207851 AATGTCCAAAAGATGGTTTGAGG - Intergenic
1156281649 18:35645037-35645059 AAAACCCAAATGAGGCTTTGGGG - Intronic
1156812143 18:41265607-41265629 AAGTCCCAAATCAATGTTTGTGG - Intergenic
1156878845 18:42050759-42050781 AAGGCCCCAATAAAGGGTTCAGG - Intronic
1156899057 18:42279239-42279261 AAGCCCTAAGTGATGGTTTGGGG + Intergenic
1164912688 19:32025595-32025617 TAGGCCCAGCTGAAGGTCTGCGG - Intergenic
1166345985 19:42166116-42166138 AAGGCCCAAGAGATAGTTTGGGG - Intronic
1166948227 19:46410208-46410230 AAGGCCCAAAAGAGGGGCTGTGG - Intergenic
925037959 2:706337-706359 GAGGCCCACCTGAAGGTCTGTGG + Intergenic
926214024 2:10892636-10892658 TAGGACCTAATGAATGTTTGAGG - Intergenic
926738362 2:16091295-16091317 AAGACCCAAAGGAGGGGTTGAGG - Intergenic
926860247 2:17301433-17301455 AAAGCCCAAATCAGGGCTTGAGG - Intergenic
932319497 2:70811268-70811290 AAGGCCAAGATGAAGGTGTATGG - Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935052732 2:99537096-99537118 AAGGCCCATATGAGGGTTATTGG - Intergenic
935143320 2:100375865-100375887 AAGGCCCATATGGTGGTTTGGGG + Intergenic
935331065 2:101978515-101978537 AAGGCCCGATTGGAGATTTGGGG + Intergenic
936684097 2:114807373-114807395 AAGGACAAAATAAATGTTTGAGG - Intronic
937174020 2:119908301-119908323 ATGGTCAAATTGAAGGTTTGTGG + Intronic
937181619 2:120001461-120001483 AAGTCCTAAATCAAGGTGTGGGG + Intergenic
938895297 2:135743036-135743058 ATGGACCAAATCAATGTTTGTGG + Intronic
939488005 2:142841382-142841404 ATGGTCCAAACGATGGTTTGGGG - Intergenic
942514126 2:176733958-176733980 AAGGTCCTAATTAAGGATTGGGG + Intergenic
942668317 2:178346599-178346621 AAGGCCCAAATTGAGTGTTGAGG + Intronic
944207187 2:197169159-197169181 AAGGCCCCAAGGAGGGTTAGGGG - Intronic
944246485 2:197535591-197535613 AAGGCCAAGATGAAGGTGTGTGG + Exonic
944511442 2:200469989-200470011 AAGGCCCAAATCATGCTCTGCGG + Exonic
945036949 2:205712048-205712070 ATGGCCCAAATGTAGGTTTGGGG + Intronic
947847780 2:233259380-233259402 CAGGCCCAGTTGAAGGGTTGGGG + Intronic
1169432589 20:5552025-5552047 AAGAGCCAAATAAAGATTTGAGG + Intronic
1170568747 20:17621242-17621264 AAGGCCAAGTTGAAGGTTCGGGG - Intronic
1173572465 20:44086275-44086297 GAGGCCACAATGTAGGTTTGGGG - Intergenic
1176913545 21:14597779-14597801 AAGGCACACATGAAGGATGGTGG - Intronic
1177698326 21:24603012-24603034 AAGGACAAAAGGAAGGTTGGAGG - Intergenic
1177785919 21:25671360-25671382 AAGGCCCAAGTGAGGGTGGGTGG - Intronic
1182015141 22:27032825-27032847 AAGACCCAAACGAAGGCATGGGG + Intergenic
1182454055 22:30438613-30438635 ATGGCTGAAATGAAGATTTGGGG - Intergenic
1183561965 22:38582175-38582197 GAGGCCCAAATAAACTTTTGGGG - Exonic
1185036120 22:48477803-48477825 AAGGCCCCAATGAAGAATTAAGG + Intergenic
951648383 3:24919903-24919925 AATGGCAAAATGAAGGTGTGTGG + Intergenic
953143519 3:40251211-40251233 AAGGCCCAAATGCACATTTTTGG - Intronic
956020196 3:64925811-64925833 CAGGCCCAGGTGAAGCTTTGTGG - Intergenic
957357869 3:79115276-79115298 AAGGGCTGAATGAATGTTTGGGG + Intronic
958428741 3:94012278-94012300 AAGGTCCAAGTGGAGGTTTTAGG - Intronic
960111214 3:113847030-113847052 AAACACCAAATGAAGATTTGAGG - Intronic
960926901 3:122803363-122803385 AAGGCACAGAGGAAGGTTTCTGG + Intronic
961416547 3:126763086-126763108 AAGGCAGAAATGAAGGACTGAGG - Intronic
964126022 3:153234369-153234391 TTGCCCAAAATGAAGGTTTGTGG + Intergenic
966156384 3:176920948-176920970 CAAGGCCAAATGAAGGTCTGGGG - Intergenic
966571000 3:181442682-181442704 AAGGTACAAATGAAGGGTGGGGG + Intergenic
966785419 3:183618876-183618898 AAGGCAGAAATGAAGGCTGGGGG - Intergenic
967040119 3:185684327-185684349 AAGGTCCTAATGAGGGTTTTAGG - Intronic
971329923 4:25673928-25673950 AAGGCAGAAATGAAGGTTGAAGG + Intronic
973285441 4:48410838-48410860 AAGCCCCGAATGAAGATGTGAGG - Intronic
975504570 4:75123828-75123850 AAGGTCCTAATGGAGATTTGGGG - Intergenic
977448696 4:97165741-97165763 AAGGCACAAATGCAGTTTAGTGG - Intergenic
978695508 4:111572453-111572475 AAAGCCTAGATGAATGTTTGTGG - Intergenic
979702826 4:123687204-123687226 AAGAACCAAAAGAAGGCTTGTGG - Intergenic
983715890 4:170780938-170780960 AAGACCGAAGTGCAGGTTTGTGG + Intergenic
984552138 4:181173412-181173434 AATGCCAAAATGAAAATTTGTGG + Intergenic
986040112 5:3985775-3985797 AAGCCTCAAAAGAAGGATTGAGG + Intergenic
988988209 5:36642401-36642423 AAGGATCAAATGGAGGTTAGTGG - Intronic
989749581 5:44877053-44877075 AAGCTCCAAATGGAGGTTTCAGG + Intergenic
992271715 5:75071215-75071237 AAGACTAAAATGAAGTTTTGAGG + Intronic
993574016 5:89579229-89579251 AAGGAACAAATGAAAGTTTGTGG - Intergenic
994052998 5:95383110-95383132 AAGGACCCACTTAAGGTTTGTGG + Intergenic
996860317 5:128058245-128058267 AAGGCAGAAAAGCAGGTTTGGGG + Intergenic
997882962 5:137606697-137606719 AAAGTCCTCATGAAGGTTTGGGG - Intergenic
998676600 5:144415578-144415600 AAGACCCAAAACAAGCTTTGAGG + Intronic
1002815222 6:673897-673919 AAAAGCAAAATGAAGGTTTGTGG - Intronic
1005437357 6:25829105-25829127 AAGGCCCAACTTATGTTTTGAGG - Intronic
1006080359 6:31561861-31561883 AAGTGCTCAATGAAGGTTTGAGG + Intergenic
1007960561 6:45955310-45955332 AACACCCAAATGCAGGTCTGAGG + Intronic
1008014156 6:46499518-46499540 AAGGTCAAAGTGATGGTTTGTGG + Intergenic
1008795323 6:55295655-55295677 AAGGTACAAATGCAGATTTGGGG + Intergenic
1011798927 6:90988351-90988373 AAGGACCAAATGAAGGTGCTGGG - Intergenic
1012056232 6:94414317-94414339 CAGACCTAAATGAAGGTGTGTGG + Intergenic
1013942492 6:115681498-115681520 AAGGGCTATATGAAGGTTGGAGG - Intergenic
1015191106 6:130473222-130473244 AAGGCTGAAATGAAGGTATCAGG - Intergenic
1019078297 6:169409700-169409722 AAGGCGGAAGTGAAGGTTTATGG + Intergenic
1021321092 7:19212381-19212403 AAGACCCCAATGAATGTTTCTGG + Intergenic
1022578609 7:31524374-31524396 AGGACACAAATGAATGTTTGGGG - Intronic
1030346019 7:108433518-108433540 CAGGCCTAAAGGAAGGTTTCTGG + Intronic
1032970657 7:137159686-137159708 AAAGCCAAAATAAAGGCTTGAGG + Intergenic
1035031797 7:155865695-155865717 GAGCCCAAAATGAGGGTTTGGGG + Intergenic
1041628837 8:60062034-60062056 CAGGCCTAAGAGAAGGTTTGTGG - Intergenic
1041718219 8:60951158-60951180 AAGGCAAATATGTAGGTTTGTGG + Intergenic
1041752598 8:61277327-61277349 AAGCCCTGAATGCAGGTTTGGGG - Intronic
1045041817 8:98231810-98231832 ATGGAACAAATGAAGATTTGGGG - Intronic
1047068001 8:121308423-121308445 CAAGACCAAATGAAGGTGTGGGG - Intergenic
1048267435 8:132999867-132999889 AAGACCCACATAAAGGATTGAGG - Intronic
1048886032 8:138910672-138910694 AAGGCCCACAGGAATGTTTTAGG - Intronic
1049644180 8:143728709-143728731 AAGGACCACATGAAGCTGTGGGG + Exonic
1049958841 9:718907-718929 TAAGCCCAAATGATGGTTTGGGG - Intronic
1050816482 9:9819346-9819368 AAGCCCCAAATGAACTTTGGCGG + Intronic
1052185902 9:25594048-25594070 AAGGCATAAAAGAAGGATTGAGG + Intergenic
1052494312 9:29208362-29208384 AATGCCCAAATGAACTTTTATGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056298662 9:85219713-85219735 AAGGCCCAAATTGGGGGTTGGGG + Intergenic
1056477666 9:86968496-86968518 AAAGACCAAATGATTGTTTGAGG - Intergenic
1058404034 9:104651472-104651494 AAGGCCGAATTGGGGGTTTGAGG + Intergenic
1059381914 9:113933637-113933659 AAGGGCCCACTGGAGGTTTGTGG + Intronic
1059745281 9:117194161-117194183 AAGGCCCACATGAGGGTTTTAGG - Intronic
1060993991 9:127865523-127865545 AATTCCCAAAGGAAGGTTTACGG + Intergenic
1061497183 9:130981731-130981753 AAGGACCAAAGGCAGCTTTGAGG - Intergenic
1061574783 9:131499360-131499382 AAGGGACAAATGAAGATTTGAGG - Exonic
1062631969 9:137467123-137467145 AAGGCACAGATGCAGGTTGGTGG - Intronic
1187196884 X:17095391-17095413 CAGGCCCAGATGAAGGCATGAGG - Intronic
1188127333 X:26385157-26385179 CAGGCCAAAGTGAAGTTTTGTGG + Intergenic
1189344565 X:40231162-40231184 AAAGTCCAAATGAAAGTTTTAGG - Intergenic
1190757514 X:53413665-53413687 AAGGACAAAATGAAGCTTGGGGG + Intronic
1192300196 X:69893049-69893071 AAGTCCAAAATCAAGGTTTTGGG + Intronic
1192834807 X:74787874-74787896 AAAGCTTAAAGGAAGGTTTGAGG - Intronic
1197289573 X:124638805-124638827 TAGGCCGAAAAGTAGGTTTGGGG - Intronic
1197707957 X:129647574-129647596 AAGGCCCAAATGAAGGTTTGGGG + Exonic
1199301996 X:146223619-146223641 AAGGCCCAAATGGTGGTATCAGG - Intergenic
1200961199 Y:8997637-8997659 AAGATCCCAATGAAGGTTTATGG + Intergenic
1201791216 Y:17842257-17842279 AAGGCCCAAAGGAAGGGAAGTGG + Intergenic
1201810338 Y:18063732-18063754 AAGGCCCAAAGGAAGGGAAGTGG - Intergenic
1202352831 Y:24011905-24011927 AAGGCCCAAAGGAAGGGAAGTGG + Intergenic
1202517948 Y:25658210-25658232 AAGGCCCAAAGGAAGGGAAGTGG - Intergenic