ID: 1197710318

View in Genome Browser
Species Human (GRCh38)
Location X:129661656-129661678
Sequence CACAATGAGGAGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197710318_1197710326 20 Left 1197710318 X:129661656-129661678 CCATCTTCCCTCTCCTCATTGTG No data
Right 1197710326 X:129661699-129661721 TCAATGCAAAAAGTGGAGTGGGG No data
1197710318_1197710324 18 Left 1197710318 X:129661656-129661678 CCATCTTCCCTCTCCTCATTGTG No data
Right 1197710324 X:129661697-129661719 GATCAATGCAAAAAGTGGAGTGG No data
1197710318_1197710327 25 Left 1197710318 X:129661656-129661678 CCATCTTCCCTCTCCTCATTGTG No data
Right 1197710327 X:129661704-129661726 GCAAAAAGTGGAGTGGGGAGAGG No data
1197710318_1197710323 13 Left 1197710318 X:129661656-129661678 CCATCTTCCCTCTCCTCATTGTG No data
Right 1197710323 X:129661692-129661714 TACTGGATCAATGCAAAAAGTGG No data
1197710318_1197710325 19 Left 1197710318 X:129661656-129661678 CCATCTTCCCTCTCCTCATTGTG No data
Right 1197710325 X:129661698-129661720 ATCAATGCAAAAAGTGGAGTGGG No data
1197710318_1197710322 -4 Left 1197710318 X:129661656-129661678 CCATCTTCCCTCTCCTCATTGTG No data
Right 1197710322 X:129661675-129661697 TGTGTAGTAGTTGTTTTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197710318 Original CRISPR CACAATGAGGAGAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr