ID: 1197711917

View in Genome Browser
Species Human (GRCh38)
Location X:129677885-129677907
Sequence ACGGCGGCTGCCTTTGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197711917_1197711924 -2 Left 1197711917 X:129677885-129677907 CCCCGGCCAAAGGCAGCCGCCGT No data
Right 1197711924 X:129677906-129677928 GTCCACACCCAGCTGCCTGAGGG No data
1197711917_1197711932 22 Left 1197711917 X:129677885-129677907 CCCCGGCCAAAGGCAGCCGCCGT No data
Right 1197711932 X:129677930-129677952 CAAGGAGGGTGTTTACCCAATGG No data
1197711917_1197711930 8 Left 1197711917 X:129677885-129677907 CCCCGGCCAAAGGCAGCCGCCGT No data
Right 1197711930 X:129677916-129677938 AGCTGCCTGAGGGACAAGGAGGG No data
1197711917_1197711926 4 Left 1197711917 X:129677885-129677907 CCCCGGCCAAAGGCAGCCGCCGT No data
Right 1197711926 X:129677912-129677934 ACCCAGCTGCCTGAGGGACAAGG No data
1197711917_1197711929 7 Left 1197711917 X:129677885-129677907 CCCCGGCCAAAGGCAGCCGCCGT No data
Right 1197711929 X:129677915-129677937 CAGCTGCCTGAGGGACAAGGAGG No data
1197711917_1197711923 -3 Left 1197711917 X:129677885-129677907 CCCCGGCCAAAGGCAGCCGCCGT No data
Right 1197711923 X:129677905-129677927 CGTCCACACCCAGCTGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197711917 Original CRISPR ACGGCGGCTGCCTTTGGCCG GGG (reversed) Intergenic
No off target data available for this crispr