ID: 1197711947

View in Genome Browser
Species Human (GRCh38)
Location X:129678017-129678039
Sequence TCCTGGCCGCCGCGAGCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197711943_1197711947 -7 Left 1197711943 X:129678001-129678023 CCTCGAAGGGGCCTCGTCCTGGC No data
Right 1197711947 X:129678017-129678039 TCCTGGCCGCCGCGAGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197711947 Original CRISPR TCCTGGCCGCCGCGAGCGGG CGG Intergenic
No off target data available for this crispr