ID: 1197717258

View in Genome Browser
Species Human (GRCh38)
Location X:129718590-129718612
Sequence TCAGGCCCACCTGATGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197717258_1197717269 10 Left 1197717258 X:129718590-129718612 CCTCAGGCATCAGGTGGGCCTGA No data
Right 1197717269 X:129718623-129718645 TGAGGAATGGGGGGTAAGTCTGG No data
1197717258_1197717261 -8 Left 1197717258 X:129718590-129718612 CCTCAGGCATCAGGTGGGCCTGA No data
Right 1197717261 X:129718605-129718627 GGGCCTGAGAGGCCTGGCTGAGG No data
1197717258_1197717265 -1 Left 1197717258 X:129718590-129718612 CCTCAGGCATCAGGTGGGCCTGA No data
Right 1197717265 X:129718612-129718634 AGAGGCCTGGCTGAGGAATGGGG No data
1197717258_1197717263 -3 Left 1197717258 X:129718590-129718612 CCTCAGGCATCAGGTGGGCCTGA No data
Right 1197717263 X:129718610-129718632 TGAGAGGCCTGGCTGAGGAATGG No data
1197717258_1197717266 0 Left 1197717258 X:129718590-129718612 CCTCAGGCATCAGGTGGGCCTGA No data
Right 1197717266 X:129718613-129718635 GAGGCCTGGCTGAGGAATGGGGG No data
1197717258_1197717264 -2 Left 1197717258 X:129718590-129718612 CCTCAGGCATCAGGTGGGCCTGA No data
Right 1197717264 X:129718611-129718633 GAGAGGCCTGGCTGAGGAATGGG No data
1197717258_1197717267 1 Left 1197717258 X:129718590-129718612 CCTCAGGCATCAGGTGGGCCTGA No data
Right 1197717267 X:129718614-129718636 AGGCCTGGCTGAGGAATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197717258 Original CRISPR TCAGGCCCACCTGATGCCTG AGG (reversed) Intergenic
No off target data available for this crispr