ID: 1197717990

View in Genome Browser
Species Human (GRCh38)
Location X:129723796-129723818
Sequence TAGTTTTATTTTTATTTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197717990_1197717997 22 Left 1197717990 X:129723796-129723818 CCTTAAAAATAAAAATAAAACTA No data
Right 1197717997 X:129723841-129723863 CACAGTCAGGCATGTTGATAGGG No data
1197717990_1197717993 9 Left 1197717990 X:129723796-129723818 CCTTAAAAATAAAAATAAAACTA No data
Right 1197717993 X:129723828-129723850 ATAGAGTCCATGCCACAGTCAGG No data
1197717990_1197717998 29 Left 1197717990 X:129723796-129723818 CCTTAAAAATAAAAATAAAACTA No data
Right 1197717998 X:129723848-129723870 AGGCATGTTGATAGGGAACCTGG No data
1197717990_1197717996 21 Left 1197717990 X:129723796-129723818 CCTTAAAAATAAAAATAAAACTA No data
Right 1197717996 X:129723840-129723862 CCACAGTCAGGCATGTTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197717990 Original CRISPR TAGTTTTATTTTTATTTTTA AGG (reversed) Intergenic
No off target data available for this crispr