ID: 1197717998

View in Genome Browser
Species Human (GRCh38)
Location X:129723848-129723870
Sequence AGGCATGTTGATAGGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197717994_1197717998 -10 Left 1197717994 X:129723835-129723857 CCATGCCACAGTCAGGCATGTTG No data
Right 1197717998 X:129723848-129723870 AGGCATGTTGATAGGGAACCTGG No data
1197717990_1197717998 29 Left 1197717990 X:129723796-129723818 CCTTAAAAATAAAAATAAAACTA No data
Right 1197717998 X:129723848-129723870 AGGCATGTTGATAGGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197717998 Original CRISPR AGGCATGTTGATAGGGAACC TGG Intergenic
No off target data available for this crispr