ID: 1197718925

View in Genome Browser
Species Human (GRCh38)
Location X:129731492-129731514
Sequence CTTTCCTTGACCTCCTGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197718925_1197718932 21 Left 1197718925 X:129731492-129731514 CCTCGCCAGGAGGTCAAGGAAAG No data
Right 1197718932 X:129731536-129731558 GAGGCAAGACTGGAAGGAAGAGG No data
1197718925_1197718930 11 Left 1197718925 X:129731492-129731514 CCTCGCCAGGAGGTCAAGGAAAG No data
Right 1197718930 X:129731526-129731548 AATGACATTTGAGGCAAGACTGG No data
1197718925_1197718931 15 Left 1197718925 X:129731492-129731514 CCTCGCCAGGAGGTCAAGGAAAG No data
Right 1197718931 X:129731530-129731552 ACATTTGAGGCAAGACTGGAAGG No data
1197718925_1197718927 2 Left 1197718925 X:129731492-129731514 CCTCGCCAGGAGGTCAAGGAAAG No data
Right 1197718927 X:129731517-129731539 TCCAGACCAAATGACATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197718925 Original CRISPR CTTTCCTTGACCTCCTGGCG AGG (reversed) Intergenic