ID: 1197718928

View in Genome Browser
Species Human (GRCh38)
Location X:129731518-129731540
Sequence GCCTCAAATGTCATTTGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197718928_1197718938 29 Left 1197718928 X:129731518-129731540 CCAGACCAAATGACATTTGAGGC No data
Right 1197718938 X:129731570-129731592 TAAAGAGAGGAAGGAAGGGTGGG No data
1197718928_1197718936 25 Left 1197718928 X:129731518-129731540 CCAGACCAAATGACATTTGAGGC No data
Right 1197718936 X:129731566-129731588 AGAGTAAAGAGAGGAAGGAAGGG No data
1197718928_1197718937 28 Left 1197718928 X:129731518-129731540 CCAGACCAAATGACATTTGAGGC No data
Right 1197718937 X:129731569-129731591 GTAAAGAGAGGAAGGAAGGGTGG No data
1197718928_1197718933 16 Left 1197718928 X:129731518-129731540 CCAGACCAAATGACATTTGAGGC No data
Right 1197718933 X:129731557-129731579 GGAGTTCACAGAGTAAAGAGAGG No data
1197718928_1197718935 24 Left 1197718928 X:129731518-129731540 CCAGACCAAATGACATTTGAGGC No data
Right 1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG No data
1197718928_1197718932 -5 Left 1197718928 X:129731518-129731540 CCAGACCAAATGACATTTGAGGC No data
Right 1197718932 X:129731536-129731558 GAGGCAAGACTGGAAGGAAGAGG No data
1197718928_1197718934 20 Left 1197718928 X:129731518-129731540 CCAGACCAAATGACATTTGAGGC No data
Right 1197718934 X:129731561-129731583 TTCACAGAGTAAAGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197718928 Original CRISPR GCCTCAAATGTCATTTGGTC TGG (reversed) Intergenic
No off target data available for this crispr