ID: 1197718935

View in Genome Browser
Species Human (GRCh38)
Location X:129731565-129731587
Sequence CAGAGTAAAGAGAGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197718928_1197718935 24 Left 1197718928 X:129731518-129731540 CCAGACCAAATGACATTTGAGGC No data
Right 1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG No data
1197718929_1197718935 19 Left 1197718929 X:129731523-129731545 CCAAATGACATTTGAGGCAAGAC No data
Right 1197718935 X:129731565-129731587 CAGAGTAAAGAGAGGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197718935 Original CRISPR CAGAGTAAAGAGAGGAAGGA AGG Intergenic
No off target data available for this crispr