ID: 1197721812

View in Genome Browser
Species Human (GRCh38)
Location X:129750460-129750482
Sequence GCTTCTAGGGAGCACTTGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197721803_1197721812 27 Left 1197721803 X:129750410-129750432 CCGAGTGCCAAAGGCAAGGTCTG 0: 1
1: 0
2: 2
3: 22
4: 235
Right 1197721812 X:129750460-129750482 GCTTCTAGGGAGCACTTGGCAGG 0: 1
1: 0
2: 2
3: 11
4: 132
1197721804_1197721812 20 Left 1197721804 X:129750417-129750439 CCAAAGGCAAGGTCTGTCACTTA 0: 1
1: 0
2: 0
3: 9
4: 146
Right 1197721812 X:129750460-129750482 GCTTCTAGGGAGCACTTGGCAGG 0: 1
1: 0
2: 2
3: 11
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197721812 Original CRISPR GCTTCTAGGGAGCACTTGGC AGG Exonic
900373820 1:2344313-2344335 GCTTCTGGGGAGCAGCTGCCTGG - Intronic
900465001 1:2821263-2821285 GCTTCTGGGGAACAGTGGGCTGG + Intergenic
902031017 1:13422336-13422358 GCTGCTCGGGAGCACGAGGCAGG - Intergenic
904537367 1:31208690-31208712 GCTTCAAGGGAGCATTTTGAGGG - Intronic
906620553 1:47274628-47274650 ACTTTTAGGGATCATTTGGCAGG + Intronic
906621717 1:47286393-47286415 ACTTTTAGGGATCATTTGGCAGG - Intronic
910401576 1:86842830-86842852 GCTTCCAGGGAGCACTTGATGGG + Intergenic
913142004 1:115950696-115950718 GCTTCTAGGGAGGATGAGGCAGG + Intergenic
914514025 1:148358373-148358395 GTTTCTAGGGAGCAGTTGTTGGG - Intergenic
915726242 1:158019662-158019684 TCTTCCAGGGAGCACGGGGCAGG + Intronic
915984977 1:160455665-160455687 GCTACTAGGGAGGATTAGGCTGG - Intergenic
921260601 1:213382557-213382579 GGTTGTAGGGAGAACTTGGCAGG + Intergenic
1066037344 10:31506671-31506693 TCTTCTAGGCAGCACATAGCTGG + Intronic
1066274952 10:33859617-33859639 GCTGGTGGGCAGCACTTGGCAGG + Intergenic
1067280905 10:44872002-44872024 GCTTCTAGGTAGCACATCTCAGG - Intergenic
1068282110 10:54886648-54886670 GCTACTCGGGAGGCCTTGGCAGG + Intronic
1074447581 10:113533241-113533263 GCTTCCAGGGAGCAGCTGGAAGG + Intergenic
1075546760 10:123361051-123361073 GCCTCTGGGTACCACTTGGCAGG + Intergenic
1081625202 11:44651323-44651345 CCTTCTGGAGATCACTTGGCAGG + Intergenic
1082694559 11:56345437-56345459 GCTTCTAGTGAGCAATTGGGGGG - Intergenic
1083479485 11:62934359-62934381 GCCTCTAGAGAGCCCTAGGCTGG - Intergenic
1083493004 11:63027001-63027023 GCTTCTAGGGAGGCCTAGGCAGG - Intergenic
1086775709 11:90830273-90830295 GCTCCTATGGAGCATTTGGATGG + Intergenic
1087771708 11:102217809-102217831 GCTACTCGGGAGGACTTGGGAGG - Intronic
1095493106 12:42756992-42757014 GTTTCTGGTGAGCACTTAGCTGG - Intergenic
1096623798 12:52880664-52880686 GCTACTTGGGATCACTTGACTGG - Intergenic
1103496051 12:121363030-121363052 GCTTCTAGGGAGGTCGAGGCAGG - Intronic
1108689118 13:52846575-52846597 ACTTCTAGGGAGCCATTGGCTGG + Exonic
1109959018 13:69606143-69606165 GTTTTTAGGGACCACTTGGTGGG - Intergenic
1112976609 13:105327231-105327253 GCTATTAGGGAGCAGGTGGCAGG + Intergenic
1116852212 14:49919638-49919660 GCTTCTAGGGAGCCTGAGGCAGG + Intergenic
1119051350 14:71372219-71372241 GCTTCCAGGAAGCAATTGGGTGG + Intronic
1121339177 14:93094780-93094802 GCCTCTAGGAAGCAGTGGGCTGG - Intronic
1121415181 14:93774416-93774438 ACTTCTAGGGGGCACTTCACAGG + Intronic
1125316576 15:38438807-38438829 TCTTGTAGGGAGCAGATGGCTGG + Intergenic
1126778183 15:52117631-52117653 GCTTCTAGACAGCACTTGGCTGG - Exonic
1128248643 15:66149952-66149974 GCTTCCAGGGAGCAATGGGATGG - Intronic
1128711688 15:69876864-69876886 GCTTCCCGGGAGGACCTGGCAGG - Intergenic
1133656560 16:7870667-7870689 GCTACTAGGGAGGACGAGGCAGG - Intergenic
1135109309 16:19678285-19678307 GCTCCCAGGTAGCACCTGGCAGG - Intronic
1135303370 16:21349565-21349587 GCTTCCAGGGTGCACATAGCAGG + Intergenic
1135893378 16:26376826-26376848 GCTTTTAAGAATCACTTGGCCGG + Intergenic
1136089049 16:27905255-27905277 ACTTCTACTGAGCACTTGGCTGG + Intronic
1137744453 16:50810467-50810489 TCAGCTAGGGAGCAGTTGGCAGG + Intergenic
1140576955 16:76182076-76182098 GGTTCTAGGGAACACCTGGAAGG + Intergenic
1140655367 16:77134195-77134217 GCTTCTGGGAAGCAATAGGCAGG + Intergenic
1142061849 16:88035529-88035551 GCTTCCAGGGTGCACATAGCGGG + Intronic
1143055067 17:4156420-4156442 TCTTCTCTGGGGCACTTGGCTGG - Intronic
1146692014 17:34883287-34883309 GCTTCTCGGCAACCCTTGGCTGG - Intergenic
1150697842 17:67421138-67421160 GGTGCTAGTGAGAACTTGGCAGG + Intronic
1154031155 18:10755699-10755721 GCTGCTAGGGAGCCCTTGCATGG + Intronic
1155510116 18:26567781-26567803 GTTTCAAAGAAGCACTTGGCCGG - Intronic
1163229700 19:15992914-15992936 GTTTCTAGGGAGCCCTTGAAGGG - Intergenic
1163251271 19:16127684-16127706 GCTTCTTGGGTGCACTCTGCGGG + Intronic
1164835801 19:31354374-31354396 GCTTTTAGGGAGCCCAGGGCTGG + Intergenic
1165774310 19:38395762-38395784 GCTTCCGGGGAGGCCTTGGCAGG - Exonic
1165862866 19:38918341-38918363 GCGTCCAGGGAGCACTGGGGGGG - Intronic
1167578219 19:50327940-50327962 GCGTCTAGGGTGGCCTTGGCGGG + Intronic
925339448 2:3126043-3126065 GCTTCCAGGGAGCCCTTGATGGG + Intergenic
925831019 2:7895591-7895613 GATTGTAGGGAGCCCTTAGCAGG - Intergenic
927455702 2:23247501-23247523 GCTTCCAGGGAGGGCTGGGCAGG + Intergenic
927882317 2:26697512-26697534 GCTTCTGGGGAGGGCTTTGCTGG - Intronic
928670491 2:33598941-33598963 GCCTGCAGGGAGCACTGGGCAGG + Intronic
930781200 2:55225765-55225787 GCTTCCAGGTAGCAGTTGGTGGG + Intronic
935332509 2:101987477-101987499 GCTTCTGGCTAGCACCTGGCAGG - Intergenic
937262551 2:120595767-120595789 GCCTGTAGGGAGCTCATGGCTGG + Intergenic
939500930 2:142983087-142983109 GCATCAAGGTAGGACTTGGCTGG + Intronic
942130860 2:172877736-172877758 GCTTCAGGCCAGCACTTGGCTGG - Intronic
945339206 2:208631492-208631514 GCTTCTAGAGAGGCCTTGGGAGG - Intronic
945810692 2:214546332-214546354 AGATCTAGGGAGCATTTGGCTGG - Intronic
946396787 2:219447479-219447501 GCTTCCAGGGACCACTAGGAAGG + Intronic
948454476 2:238098380-238098402 GCTTCTGGGAAGCCCGTGGCAGG + Exonic
1169186187 20:3619128-3619150 GCTTCAAGGCAGCACCTGTCAGG - Intronic
1170868502 20:20182700-20182722 GCTTCTACATAGCAATTGGCAGG - Intronic
1171027282 20:21642206-21642228 GCTTCTTGTGATCACTTGACTGG + Intergenic
1174044595 20:47724510-47724532 CCTTCTAGGGAGCGGATGGCTGG - Intronic
1175371990 20:58498550-58498572 GCTGATAGGGACCACTTGGGCGG + Intronic
1175644012 20:60656159-60656181 CCTTCTAGGGTGCACTGGGAAGG - Intergenic
1175955445 20:62606723-62606745 CGTGCTAGGGAGCACTGGGCTGG + Intergenic
1176193493 20:63825287-63825309 GCTTCTAGGGAGGCCAAGGCAGG + Intronic
1178208592 21:30500559-30500581 GCTACTTGGGAGGCCTTGGCAGG + Intergenic
1181015640 22:20066894-20066916 GCTGCTGGGGAGCCCTGGGCAGG - Intergenic
1181098172 22:20520465-20520487 CCTACTACAGAGCACTTGGCAGG - Intronic
1184388263 22:44188356-44188378 GCTTGTGGGGAACACTTGCCCGG - Intronic
950085022 3:10251185-10251207 GCTTCTAGGGAGCAGTCTGGTGG + Intronic
952852081 3:37737639-37737661 GCATCTAGGTAGCACTTGGCTGG + Intronic
956487936 3:69740917-69740939 GCCTCTGGCGAGCACTGGGCTGG + Intronic
961380103 3:126491493-126491515 GCTTCCAGGAAGCACTGGGTGGG + Intronic
966382279 3:179355838-179355860 GCTACTTGGGAGGCCTTGGCAGG + Intronic
968360283 3:198142262-198142284 TCTTCTAGTGAGCATTGGGCTGG - Intergenic
968528183 4:1075383-1075405 GCTTCTGGGGAGGCCTTGGGAGG + Intronic
968623001 4:1612381-1612403 GCTTCTCGGGAGGCCCTGGCGGG - Intergenic
968651002 4:1760305-1760327 TGTTCTAGGGACCACTTAGCTGG - Intergenic
969274957 4:6128699-6128721 GACTCTAGAGAGGACTTGGCAGG - Intronic
973814360 4:54605126-54605148 GCTTCTAGCGACCACTAGGAGGG - Intergenic
974929543 4:68346301-68346323 GCTACTAGGGAGCCCTTGGGAGG + Intronic
977839201 4:101681154-101681176 GCTTCCAGGGATCAATAGGCAGG - Intronic
977955787 4:103024072-103024094 GCTGCTAGGGAGCTCATGGCAGG - Intronic
978003691 4:103589961-103589983 GCTTCAAGAGAGCATTTCGCTGG - Exonic
982035311 4:151340176-151340198 GCTACTTGGGAGCCTTTGGCAGG + Intergenic
982171384 4:152665100-152665122 GCTTCTAGGGAGAACGAAGCAGG + Intronic
984666723 4:182436904-182436926 GCTACTAGGGAGTACTAGGGAGG + Intronic
985284076 4:188316677-188316699 GCTTCTAGAGAGCACTAGAGAGG - Intergenic
985702797 5:1383660-1383682 GCTTTGAGGAAGCACATGGCTGG - Intergenic
987012299 5:13779941-13779963 GCTCCTAGGGAGGACATGTCAGG - Intronic
989053977 5:37348190-37348212 GCTACTAGGGAGCCTGTGGCAGG + Intronic
994713464 5:103294418-103294440 GCTTGTTGGGAGCACATGCCTGG + Intergenic
998226749 5:140333020-140333042 CCTTCTCGGTAGCAATTGGCAGG + Exonic
998454800 5:142263529-142263551 GCTTCCAGAGAGCACATAGCAGG - Intergenic
998467645 5:142358291-142358313 ACTTCCAGGGAGCTCTGGGCCGG + Intergenic
998776506 5:145609676-145609698 TCTTCTGGGAAGCACTTGGATGG - Intronic
1001028469 5:168244341-168244363 GCTTCTGTGGAGGACATGGCTGG - Intronic
1003264361 6:4552486-4552508 GCTTCTTGGGAGTAGGTGGCTGG - Intergenic
1006182862 6:32164432-32164454 ACTTCTAGGGAGCCCTTTGCTGG + Intronic
1009234084 6:61101842-61101864 ACTTCTTGGGATCTCTTGGCAGG - Intergenic
1009504759 6:64463056-64463078 GCTGCTTGGGAGGCCTTGGCAGG - Intronic
1022456290 7:30561084-30561106 GCTTCTAGGGAGGCCGAGGCAGG + Intergenic
1027050178 7:75016832-75016854 GCTTCCTGGGAGGACTGGGCAGG - Intronic
1027348123 7:77282738-77282760 GCATCCAGGGACCTCTTGGCTGG - Exonic
1027362407 7:77422808-77422830 GCTTTTAGGGATAATTTGGCAGG - Intergenic
1029382858 7:100224831-100224853 GCTTCCTGGGAGGACTGGGCAGG + Intronic
1029413536 7:100429851-100429873 GCTAGTAGGGCGCACTTGGCGGG + Exonic
1030999713 7:116400677-116400699 GCTTTTAGGGACAACTTGGTGGG + Intronic
1033227670 7:139574070-139574092 GCTTCTCGGGAGCCCAAGGCGGG - Intronic
1034557794 7:151860931-151860953 GCTTCTAGGTAGAGCTTGCCAGG + Intronic
1037458245 8:19084323-19084345 GCTCCTGGGGAGTATTTGGCAGG + Intronic
1038654609 8:29437970-29437992 GCTTCTAGGGAGGCCGAGGCAGG - Intergenic
1039061985 8:33579340-33579362 GCTACTAGGGAGGCCGTGGCAGG - Intergenic
1041991641 8:63999622-63999644 GCTTCTAGGGGGCTCCTGCCTGG - Intergenic
1045491927 8:102676563-102676585 GGTTTTAGAGAGCACTTGGTGGG - Intergenic
1046931151 8:119843198-119843220 GCTGCTAGGGAGCCCGAGGCAGG - Intronic
1048787427 8:138064906-138064928 GTAGCGAGGGAGCACTTGGCAGG - Intergenic
1050093962 9:2044319-2044341 GACTCCAGGGAGCACATGGCAGG + Intronic
1051250848 9:15157349-15157371 GCTACTCGGGAGGCCTTGGCAGG + Intergenic
1055071562 9:72171711-72171733 CCTTTTAGGTAGCACTTTGCAGG - Intronic
1056708077 9:88968730-88968752 GTCTCTAGGTAGCATTTGGCAGG + Intergenic
1059336107 9:113569335-113569357 GCCTCTGGGGACCACATGGCTGG + Intronic
1060110302 9:120902097-120902119 GCTTTTCGGGGGCACGTGGCAGG - Intergenic
1061486216 9:130921746-130921768 GCTTCTGGGAACCCCTTGGCGGG - Intronic
1062744983 9:138206090-138206112 TCTTCTAGTGAGCATTGGGCTGG - Intergenic
1186126274 X:6417931-6417953 GATTCAAGGGAGCACTTGTCTGG + Intergenic
1187293299 X:17975786-17975808 TCTTCGAGGATGCACTTGGCTGG + Intergenic
1189687580 X:43581478-43581500 TCTTCTAGGGATCATTTGGTGGG + Intergenic
1193435235 X:81467225-81467247 TCTTCTGAGGAGCACATGGCAGG + Intergenic
1197721812 X:129750460-129750482 GCTTCTAGGGAGCACTTGGCAGG + Exonic
1199971639 X:152866011-152866033 GCATTCAGAGAGCACTTGGCAGG + Intronic