ID: 1197722795

View in Genome Browser
Species Human (GRCh38)
Location X:129756292-129756314
Sequence GGATTAACAGACGTGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1197722786_1197722795 14 Left 1197722786 X:129756255-129756277 CCTCCCTGGGGACCAGGGCCTGG 0: 1
1: 0
2: 7
3: 81
4: 645
Right 1197722795 X:129756292-129756314 GGATTAACAGACGTGTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 75
1197722788_1197722795 11 Left 1197722788 X:129756258-129756280 CCCTGGGGACCAGGGCCTGGCTC 0: 1
1: 0
2: 3
3: 74
4: 429
Right 1197722795 X:129756292-129756314 GGATTAACAGACGTGTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 75
1197722791_1197722795 2 Left 1197722791 X:129756267-129756289 CCAGGGCCTGGCTCAGCCAGGTG 0: 1
1: 1
2: 3
3: 55
4: 474
Right 1197722795 X:129756292-129756314 GGATTAACAGACGTGTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 75
1197722783_1197722795 23 Left 1197722783 X:129756246-129756268 CCTCTCTCTCCTCCCTGGGGACC 0: 2
1: 1
2: 7
3: 79
4: 679
Right 1197722795 X:129756292-129756314 GGATTAACAGACGTGTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 75
1197722793_1197722795 -4 Left 1197722793 X:129756273-129756295 CCTGGCTCAGCCAGGTGCAGGAT 0: 1
1: 0
2: 1
3: 16
4: 232
Right 1197722795 X:129756292-129756314 GGATTAACAGACGTGTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 75
1197722789_1197722795 10 Left 1197722789 X:129756259-129756281 CCTGGGGACCAGGGCCTGGCTCA 0: 1
1: 0
2: 5
3: 66
4: 420
Right 1197722795 X:129756292-129756314 GGATTAACAGACGTGTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 75
1197722782_1197722795 24 Left 1197722782 X:129756245-129756267 CCCTCTCTCTCCTCCCTGGGGAC 0: 1
1: 0
2: 9
3: 76
4: 612
Right 1197722795 X:129756292-129756314 GGATTAACAGACGTGTGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197722795 Original CRISPR GGATTAACAGACGTGTGCTG AGG Intronic
903663498 1:24993090-24993112 AGTTTTCCAGACGTGTGCTGGGG + Intergenic
905736970 1:40335925-40335947 GGATCAACAGGAGTTTGCTGAGG - Intergenic
906754563 1:48297712-48297734 GGCTTCACAGGTGTGTGCTGGGG + Exonic
912509670 1:110180389-110180411 AGATTAGCAGTAGTGTGCTGGGG - Intronic
912557575 1:110527288-110527310 AGATTAGCAGTAGTGTGCTGGGG + Intergenic
1066196960 10:33109856-33109878 GGATCAAGAGAAGTCTGCTGAGG + Intergenic
1068120942 10:52781347-52781369 TGATTAACAAATGTTTGCTGTGG - Intergenic
1074087591 10:110220221-110220243 GGAATCTCAGAGGTGTGCTGAGG + Intronic
1077805646 11:5589054-5589076 GGATTTACAGACGTGAGCCAGGG + Intronic
1078444529 11:11394324-11394346 GGAGTAACAGATGTGGGCTATGG + Intronic
1089896946 11:121940172-121940194 GGATTAACAGGCGTGAGCCGTGG + Intergenic
1091822557 12:3487197-3487219 GGATTCACTGCAGTGTGCTGTGG + Intronic
1093932652 12:24969755-24969777 TCATTAGCAGAGGTGTGCTGTGG + Intergenic
1093971501 12:25380167-25380189 GGATTAACAGACCTATCCGGAGG - Intergenic
1098099345 12:66997306-66997328 AGAATTACAGACATGTGCTGTGG - Intergenic
1107917119 13:45164043-45164065 GGAATTACAGATGTGTGCTGAGG - Intronic
1109269739 13:60241510-60241532 GAATAAACAGAGGTGAGCTGAGG - Intergenic
1111931630 13:94518660-94518682 GGATGCAGAGACGTGTGCAGAGG - Intergenic
1118314758 14:64719171-64719193 GGATAAACACACGGGTGGTGGGG + Intronic
1120297739 14:82664999-82665021 GGATTAGTAGGAGTGTGCTGGGG + Intergenic
1122822368 14:104354037-104354059 GGAGGAACAGACGTGTGGTCGGG + Intergenic
1123148482 14:106157699-106157721 GTAATAACTGATGTGTGCTGAGG - Intergenic
1124339108 15:28878488-28878510 GGAGACACAGAAGTGTGCTGGGG - Intergenic
1126382338 15:48061929-48061951 GTATTACCAGGCGTGTGCTACGG - Intergenic
1126755681 15:51923025-51923047 GGAGTAACAGAGGTGTGATGGGG - Intronic
1128723485 15:69970603-69970625 GGAATATCACACGTGTGCTTTGG - Intergenic
1129994313 15:79991396-79991418 GGATTTACAGATGTGTGCCATGG + Intergenic
1130931939 15:88435765-88435787 GGATTAACAGATGTGGTCGGGGG - Intergenic
1131311492 15:91294744-91294766 GGATTAACATTGGAGTGCTGGGG + Exonic
1133166557 16:3951900-3951922 GGATGAACAGGTGTGTGCAGCGG - Intergenic
1136681728 16:31969941-31969963 GTAATAACTGATGTGTGCTGAGG + Intergenic
1136782034 16:32911443-32911465 GTAATAACTGATGTGTGCTGAGG + Intergenic
1136887755 16:33942408-33942430 GTAATAACTGATGTGTGCTGAGG - Intergenic
1139143026 16:64291437-64291459 GGAGTCACAGAAGTGTGCTGTGG - Intergenic
1141121523 16:81362134-81362156 GAATGAACAGATGTGCGCTGCGG + Intronic
1203084695 16_KI270728v1_random:1175430-1175452 GTAATAACTGATGTGTGCTGAGG + Intergenic
1145114794 17:20199220-20199242 GGAGTTACAGGCATGTGCTGTGG + Intronic
1146898505 17:36564013-36564035 GGATTAACAGGCGTGAGCCACGG + Intronic
1151735596 17:75938287-75938309 GGATTAACAGGCGTGAGCCATGG - Intronic
1163383811 19:16986566-16986588 GGATTAACAGCCCTTTGCAGAGG - Intronic
1163506913 19:17713012-17713034 GGATTAACAGGCGTGAGCCATGG + Intergenic
1166048012 19:40241056-40241078 GGAATTACAGGCGTGAGCTGTGG + Intronic
1167861835 19:52290814-52290836 GGATTAACAGATGGGTGGTGAGG - Exonic
926387356 2:12349873-12349895 GGATTCACACACATGAGCTGAGG - Intergenic
932855491 2:75229665-75229687 GAATTGACAGAAGTGTTCTGTGG + Intergenic
933884871 2:86709555-86709577 GGATTAAAAGCCAGGTGCTGTGG - Intronic
933925301 2:87087136-87087158 GGATTAAAAGCCAGGTGCTGTGG + Intergenic
936343701 2:111659328-111659350 TGATGAACAAACTTGTGCTGTGG + Intergenic
939864960 2:147462222-147462244 GGAGAAACACACGTGTCCTGAGG - Intergenic
948270429 2:236669599-236669621 GGATGACCAGAAGTGTGGTGGGG - Intergenic
948946835 2:241224678-241224700 GGTTCAACAGACCTTTGCTGTGG - Exonic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1182147558 22:28006027-28006049 GGATGAAAAGCCGTGTGCAGTGG + Intronic
955776007 3:62433710-62433732 GGATTAAAAGAGATGTGCTTAGG - Intronic
963145784 3:141992202-141992224 GGTTTGACAGACGGGTGGTGGGG + Intronic
963499097 3:146102062-146102084 GGATTAACAGATTTTTGTTGTGG - Intronic
969585208 4:8087564-8087586 GAATTAACAGAGGGGAGCTGAGG + Intronic
969639318 4:8387601-8387623 GGCTTTACAGACGGGGGCTGTGG + Intronic
981569534 4:146136968-146136990 GAAGAAACAGACATGTGCTGTGG - Intergenic
996155292 5:120091904-120091926 GGATTAAATTATGTGTGCTGTGG + Intergenic
1001806616 5:174592262-174592284 GCCTTATCAGACCTGTGCTGAGG + Intergenic
1006724302 6:36185733-36185755 GGATTAAAATATGTGTGTTGGGG + Intergenic
1015046597 6:128783497-128783519 GGATTAGCAAAGCTGTGCTGAGG + Intergenic
1016578504 6:145600412-145600434 GGATTAACAGTGGTGTGAGGGGG - Intronic
1017722406 6:157253133-157253155 GCATGGACAGCCGTGTGCTGTGG + Intergenic
1018953353 6:168392580-168392602 GGAATAAGACAGGTGTGCTGGGG - Intergenic
1019794882 7:3042337-3042359 GCATTAACAGAAGACTGCTGGGG + Intronic
1020626488 7:10587504-10587526 GGATTGACAGACTTGGTCTGTGG + Intergenic
1036844520 8:12155638-12155660 GGATTAACAGGCGTGAGCCACGG + Intergenic
1039373895 8:37013998-37014020 GGAGAAACAGGCGAGTGCTGAGG + Intergenic
1045417157 8:101978778-101978800 AGATCAACAAATGTGTGCTGAGG + Intronic
1045942676 8:107756700-107756722 GGATTAACAGGCGTGAGCCACGG - Intergenic
1047124390 8:121944434-121944456 GGGATAACAGAGGTTTGCTGAGG + Intergenic
1047917122 8:129594148-129594170 TGTTGAACAGACGTTTGCTGTGG - Intergenic
1049207747 8:141371308-141371330 GGTTTAACAGAAGGGTACTGGGG - Intergenic
1053348029 9:37392458-37392480 GGATTAACAGCCTCATGCTGTGG - Intergenic
1057460581 9:95257245-95257267 GTTTTAACAGAAGTGTGATGTGG - Intronic
1061888897 9:133607357-133607379 GGCATGACAGACGTGTGTTGGGG + Intergenic
1196898243 X:120359094-120359116 GAATTAAGAGAAGTGTGCAGAGG - Intergenic
1197722795 X:129756292-129756314 GGATTAACAGACGTGTGCTGAGG + Intronic
1198981528 X:142402822-142402844 TGTTTTACAGACGTGTGTTGTGG + Intergenic