ID: 1197723042

View in Genome Browser
Species Human (GRCh38)
Location X:129757978-129758000
Sequence AGTCACACGTTTGGAAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1197723042 Original CRISPR AGTCACACGTTTGGAAGGAA TGG (reversed) Intronic
903401609 1:23056017-23056039 TGTCACACTTTTGGAAGCCAGGG + Exonic
905115799 1:35639805-35639827 ATTCACTCCTTTGGAAGGACTGG + Intronic
905992411 1:42350022-42350044 AAAAACAGGTTTGGAAGGAAAGG - Intergenic
906074682 1:43043255-43043277 AGTCAAATGTTTGAAAAGAACGG + Intergenic
909151151 1:72007029-72007051 AGTTTGACTTTTGGAAGGAATGG - Intronic
912093759 1:106114262-106114284 TGGAACACTTTTGGAAGGAATGG - Intergenic
914227602 1:145734146-145734168 AAAAACACCTTTGGAAGGAAAGG - Intronic
921781097 1:219165164-219165186 ATTCACACTTTTGCAAGGGAAGG + Intergenic
1062974084 10:1670890-1670912 ACTCAGACGTCTGGAAGGGACGG + Intronic
1065261733 10:23930884-23930906 AGGCACACGTGAGGAAGGACAGG - Intronic
1066145001 10:32548309-32548331 AGTCAGTAGTTTGGCAGGAAGGG + Intronic
1067745702 10:48934104-48934126 AGTCACACGTCTAGGAGGACAGG - Intronic
1068173050 10:53421366-53421388 AGTCACACCTTTGGAAATGAAGG - Intergenic
1070331058 10:75417627-75417649 AGTCACAGGTTTGAAATGCAGGG + Intergenic
1071307730 10:84313971-84313993 AGTGACTCATCTGGAAGGAATGG + Intergenic
1071599841 10:86953751-86953773 GGTCAGAGGTTTGCAAGGAATGG - Intronic
1074510036 10:114103179-114103201 AGCCAGACATTTGGAAGAAAGGG - Intergenic
1076714044 10:132354372-132354394 GGTCACACCTTGGGAAGCAAAGG - Intronic
1079100291 11:17537375-17537397 AAGAACATGTTTGGAAGGAAGGG - Intronic
1080166696 11:29245494-29245516 AGTCACATGGTGGTAAGGAATGG - Intergenic
1082117593 11:48344161-48344183 AGTCAGACGTTTTGAAGTTAGGG - Intergenic
1083350870 11:62027976-62027998 AGGAACACTTTTGGAAGCAAGGG + Intergenic
1083679663 11:64345293-64345315 AGGCACACCTTTGGAAGGCAGGG - Intronic
1085170450 11:74445283-74445305 AGTCCCATGTTGGGCAGGAATGG - Intergenic
1085960985 11:81461668-81461690 AGTGACACATGTGGAGGGAAGGG - Intergenic
1089662539 11:119994694-119994716 AGTCACCAGTTTTGGAGGAATGG - Intergenic
1089737051 11:120556795-120556817 AGTCACAATTAAGGAAGGAACGG - Intronic
1091683288 12:2542008-2542030 AGTCTCAGGATGGGAAGGAAGGG + Intronic
1092764352 12:11839226-11839248 AGCAACACGTTTGAAATGAATGG + Exonic
1092774707 12:11932440-11932462 GGACACACATTTGAAAGGAAAGG + Intergenic
1093023911 12:14229458-14229480 AGTCCTACGTTTGGAGGAAAAGG - Intergenic
1094635057 12:32218243-32218265 AGTTACAAGTTAGGAATGAATGG + Intronic
1097949316 12:65409024-65409046 AGGCCCATTTTTGGAAGGAAGGG - Intronic
1098990354 12:77059067-77059089 AGTAACTCTTTTGGAAGCAATGG - Intronic
1099167796 12:79328006-79328028 AGTCTCACATTTGGGAGGCAGGG + Intronic
1101424418 12:104576284-104576306 GGTCACACGCTTGGAAGAACAGG + Intronic
1102512870 12:113427737-113427759 AGCCACACTTATGGAATGAAAGG + Intronic
1107105850 13:36641724-36641746 AGTCACACCTTGGGAATGATGGG + Intergenic
1109128325 13:58546902-58546924 TCTCACATGTTTGGAAAGAATGG + Intergenic
1118072277 14:62258168-62258190 AGAAACTCATTTGGAAGGAAAGG + Intergenic
1119907871 14:78322024-78322046 AGTAAGAATTTTGGAAGGAATGG - Intronic
1120441420 14:84545717-84545739 GGTCACACTTTGAGAAGGAAGGG - Intergenic
1122390429 14:101377402-101377424 AGTAACACTTGTGGAAGAAAAGG - Intergenic
1123106593 14:105844702-105844724 AGTCACACTTTGGTAAGGAGAGG - Intergenic
1128811592 15:70577013-70577035 AGTCTCAGAGTTGGAAGGAAGGG + Intergenic
1130267483 15:82420911-82420933 ACTCACACTTATGGAGGGAATGG + Intergenic
1130504542 15:84525923-84525945 ACTCACACTTATGGAGGGAATGG - Intergenic
1135917076 16:26614774-26614796 AGTCACAGGCTGGGAAGAAAGGG + Intergenic
1136039208 16:27564694-27564716 AGGCACACGTGGGGAATGAAGGG + Intronic
1137315219 16:47312329-47312351 AGTCACCTGCTTAGAAGGAAAGG - Intronic
1138118008 16:54375566-54375588 ATTCACACGTTGTGAAGTAAAGG + Intergenic
1149906296 17:60529207-60529229 AGTCTCCCTTTGGGAAGGAAAGG + Intergenic
1152355898 17:79807089-79807111 AGTCCCACGATTTGAAGGGACGG - Intergenic
1155354967 18:24943235-24943257 AACCCCACCTTTGGAAGGAAAGG + Intergenic
1158985074 18:62806329-62806351 ACTGATACATTTGGAAGGAAAGG + Intronic
1160033530 18:75281886-75281908 AGGGACACTTTTGGAAGGCAGGG - Intronic
927975707 2:27336593-27336615 AGACAGACTTTGGGAAGGAAAGG - Intronic
928274515 2:29887711-29887733 AGTCACACTGTGGGTAGGAAAGG + Intronic
932186227 2:69698574-69698596 AGTGTCACCTATGGAAGGAATGG + Intronic
933714743 2:85351697-85351719 TGTCATACCTTTGGAAAGAATGG - Exonic
934771519 2:96910642-96910664 GGTCTCAGGTTTGGAAAGAAGGG - Intronic
936904719 2:117524357-117524379 AATCACTCATTGGGAAGGAAAGG - Intergenic
937452136 2:122010515-122010537 AGCCACATCTGTGGAAGGAAGGG + Intergenic
938711836 2:133981790-133981812 AAACACAGGCTTGGAAGGAACGG + Intergenic
939720865 2:145649444-145649466 AGTCTCAGGTTGGGAATGAATGG - Intergenic
945630796 2:212273757-212273779 CTTCACACCTTTGTAAGGAAAGG + Intronic
945943597 2:215973246-215973268 AGGCAGAAGTTTGGAGGGAATGG - Intronic
948339650 2:237239251-237239273 AGACTCACTGTTGGAAGGAAAGG + Intergenic
948366151 2:237456146-237456168 AGTCACACGTACAGAAGGATTGG + Intergenic
948625410 2:239265291-239265313 AGTCACACGTTTGAAGGGGAGGG - Intronic
1169389549 20:5178573-5178595 AGTCTCAAGTTTGGGAGAAATGG + Intronic
1170071510 20:12374179-12374201 ATTGACACCTGTGGAAGGAAGGG - Intergenic
1173640488 20:44598453-44598475 AGTCTCAAGTGTGGAATGAAGGG - Intronic
1174431066 20:50469446-50469468 AGTCACACAGCTGGTAGGAAGGG - Intergenic
1175942391 20:62543521-62543543 AGTCACAGGTTTGCCAGGGAGGG - Intergenic
1177226147 21:18259206-18259228 AGTTACACTTTTGGAACAAATGG + Intronic
1178124851 21:29505289-29505311 AGTAACAAGTATGGAAGGTAAGG + Intronic
1182143335 22:27981295-27981317 ATTATCAAGTTTGGAAGGAAAGG - Exonic
1183593316 22:38794249-38794271 AGTCAGGCGTTTGCAAGGACAGG + Intergenic
1183789904 22:40058373-40058395 AGTCACAAGTTTTGGAGGACAGG - Intronic
949293385 3:2492284-2492306 TGGGACACGTTTAGAAGGAAGGG - Intronic
951299043 3:20972343-20972365 AGTCCCACTTTTTGAGGGAAGGG - Intergenic
951352448 3:21622947-21622969 AGTGACAAGTTGGGAAAGAAAGG - Intronic
952013742 3:28932505-28932527 AGTCATACAATTGCAAGGAAAGG + Intergenic
952183601 3:30944937-30944959 AGTCACATGGTAGGATGGAAGGG - Intergenic
953886937 3:46719394-46719416 AGTCCCACATTTGGAAGAAGAGG + Intronic
955641792 3:61093560-61093582 TGTAACAGATTTGGAAGGAAAGG + Intronic
958681423 3:97336842-97336864 TGTCACACATTTGAGAGGAAAGG + Intronic
964060573 3:152517395-152517417 AGGGACAAGGTTGGAAGGAAAGG + Intergenic
964238628 3:154564615-154564637 AGACACAGGTTTGGAAATAAGGG + Intergenic
971720255 4:30235841-30235863 AGACATACATTTGGAAGGTATGG + Intergenic
973916173 4:55636536-55636558 ATTCCCACCTTTGGAAGGACTGG + Intronic
976879508 4:89902072-89902094 AGTCACAGTTTTGCAAGGAAGGG + Intronic
980317665 4:131223620-131223642 AGTCAAACGTTACTAAGGAAGGG + Intergenic
983268762 4:165536523-165536545 AGACAAACGTTTGGCAGAAAGGG + Intergenic
984625266 4:181999967-181999989 TTTCACAGGTTTGGAAGGTATGG - Intergenic
985782866 5:1880189-1880211 TGTAACACGTGTGGCAGGAAGGG + Intronic
986085129 5:4437400-4437422 AGACACACCTTTGGCTGGAAGGG - Intergenic
986559855 5:9049645-9049667 AGTCACACATGTGGAAGTTAAGG + Intronic
987356745 5:17070087-17070109 AGCTACAAGGTTGGAAGGAAAGG - Intronic
990355185 5:54960070-54960092 AGTAACACCTGTGGAAGGAAAGG + Intergenic
990590274 5:57255469-57255491 AGTCACACAATTGGTAGAAAGGG + Intronic
992108694 5:73471986-73472008 AGTCAAGCAATTGGAAGGAAAGG + Intergenic
993107481 5:83615490-83615512 GGCCACAGGTTGGGAAGGAAGGG + Intergenic
995823810 5:116269942-116269964 TGTCACAAATTTGAAAGGAAGGG + Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997766780 5:136512705-136512727 AGACACACAGTTGGAAGTAAGGG + Intergenic
998250171 5:140547300-140547322 AGTCACACATCTTGCAGGAAGGG - Intronic
999621368 5:153477981-153478003 TGTCACAACTTTGGATGGAAAGG - Intergenic
1004698213 6:18053995-18054017 AGTGACATGTTGGGAAGGAAGGG + Intergenic
1010780839 6:79944851-79944873 AGTCAAATGTTTGGAAAGAAGGG - Intronic
1011894939 6:92214240-92214262 AATGACAGGTTTGGAAGGGAGGG + Intergenic
1014016261 6:116533832-116533854 AGTAGCAAGTTAGGAAGGAAAGG - Intronic
1016240754 6:141927067-141927089 GGTCACACTTTTAGAAGGAGGGG + Intergenic
1016402079 6:143691973-143691995 AGGCACACAATTGAAAGGAAAGG - Intronic
1016496198 6:144664973-144664995 AGTCTGACTTTTGAAAGGAATGG + Intronic
1018307352 6:162471495-162471517 AGCCACAGGTTAGAAAGGAAAGG - Intronic
1019978972 7:4606945-4606967 GGTGACGCCTTTGGAAGGAAGGG - Intergenic
1022975634 7:35553441-35553463 AGAGACACACTTGGAAGGAAAGG - Intergenic
1023005854 7:35866617-35866639 ATTCACAGTCTTGGAAGGAATGG + Intronic
1028659253 7:93249885-93249907 ACTCACACGTGTGGAAGGGAAGG - Intronic
1029789071 7:102823429-102823451 AGACAGATGTTTGGAAGCAAGGG + Intronic
1033568472 7:142602628-142602650 ATCCACATGTTTAGAAGGAAGGG + Intergenic
1036287621 8:7458578-7458600 AGTCACACGTTGAGAAAGAAAGG + Intronic
1036333859 8:7852947-7852969 AGTCACACGTTGAGAAAGAAAGG - Intronic
1037049025 8:14345813-14345835 AGTCACACAGTAGGAAGGGATGG - Intronic
1038510751 8:28132357-28132379 AGTCCCACGTTTGGCAGGTCAGG - Exonic
1040470789 8:47734367-47734389 ACTCACACCTTTGAAGGGAAGGG + Intronic
1045087404 8:98701168-98701190 TGTCACATGGATGGAAGGAAGGG + Intronic
1046638272 8:116697149-116697171 AGGCACAGGTTTGGGAGGGAAGG - Intronic
1049860060 8:144892173-144892195 ACACACACATTTGGAGGGAATGG - Intronic
1052620211 9:30898944-30898966 AGTCACACCTTTGGAGAGAGAGG + Intergenic
1057196240 9:93116795-93116817 AGCCACAGGTTTGGAGGGAGTGG + Intergenic
1057343335 9:94223626-94223648 AGTAACACTTATGAAAGGAAAGG - Intergenic
1057918449 9:99075677-99075699 AGGCACAAGTTTGGAAGGAGAGG - Intergenic
1060416259 9:123432785-123432807 AGTCAAACATGTGGAAAGAAGGG - Intronic
1061594291 9:131618982-131619004 AGGCACACGCTTCCAAGGAACGG + Intronic
1062181591 9:135193934-135193956 AGTCACTTGTTTGGAAAGAAAGG - Intergenic
1062459142 9:136655606-136655628 GGTCACACGGCTGGCAGGAATGG + Intergenic
1185580842 X:1210634-1210656 AGTTACAGGTTTGGAAAGATGGG + Intronic
1189681630 X:43522447-43522469 AGTCACACGTTTAGAAGAGGTGG + Intergenic
1191599104 X:62983728-62983750 AGTCACACTTATGCAAGGAGTGG + Intergenic
1196882360 X:120209990-120210012 TGTAAAACCTTTGGAAGGAAAGG - Intergenic
1197723042 X:129757978-129758000 AGTCACACGTTTGGAAGGAATGG - Intronic
1198330624 X:135619284-135619306 TGTCACATGGTGGGAAGGAAAGG + Intergenic
1198336304 X:135669712-135669734 TGTCACATGGTGGGAAGGAAAGG - Intergenic
1198363324 X:135916941-135916963 TGTCACATGGTTGGAGGGAAAGG + Intergenic
1201459015 Y:14201751-14201773 AGACATATATTTGGAAGGAATGG - Intergenic
1202365384 Y:24158665-24158687 ACTCACACTTATGGAGGGAATGG + Intergenic
1202505397 Y:25511457-25511479 ACTCACACTTATGGAGGGAATGG - Intergenic